Фотостарение последствия: Фотостарение — СПБ ГБУЗ «Кожно-венерологический диспансер № 4»

Содержание

Фотостарение — СПБ ГБУЗ «Кожно-венерологический диспансер № 4»

         Фотостарение (дерматогелиоз, гелиодерматит, преждевременное старение кожи, актинический дерматоз, photoaging) — изменения, связанные с хроническим воздействием ультрафиолетового излучения и накоплением фотоповреждений кожи.

          Фотоповреждения — это повреждения получаемые от воздействия ультрафиолетовых лучей на кожу. Кожа может получать фотоповреждения в любое время года и даже в ненастную погоду, зимой, если на ней нет SPF защиты. Фотоповреждения накапливаются с течением времени, что в дальнейшем приводит к фотостарению.

Ультрафиолет оказывает действие на ряд факторов, сбой в функционировании которых ведёт к развитию неблагоприятных для кожи последствий:

 Основные признаки фотостарения:

  • Гиперкератоз (усиленное ороговение)
  • Солнечное лентиго (веснушки, пигментные пятна, гиперпигментация)
  • Сеть мелких морщин на лице, шее, в зоне декольте
  •  Потеря упругости и эластичности, сухость и дряблость кожи лица и шеи
  •  Расширенные поры
  • Телеангиэктазии
  • Замедление естественной регенерации
  • Эластоз

Механизмы фотострения:

          ДНК — уникальная молекула, несущая в себе генетическую информацию о  строении и свойствах всех клеточных белков. Повреждение ДНК приводит к постоянному воспроизводству уже повреждённых клеток.

Как происходит молекулярное повреждение цепочек ДНК?

          Фотоны ультрафиолетовых лучей поглощаются специфическими фотохромофорами в коже и передают им свою энергию. Каждый из фотохромофоров поглощает энергию лучей определённого спектра. Молекула ДНК может поглощать ультрафиолетовые лучи B спектра. Поэтому первые солнцезащитные крема защищали кожу от UVB лучей
Поглощая энергию фотонов молекула ДНК повреждается, мутирует. Если бы молекула погибала, организм бы её восстанавливал, но, в  случае с фотоповреждениями организм не всегда замечает их, что приводит к производству новых повреждённых молекул, уже самим организмом.

          В отличие от прямого (молекулярного) фотоповреждения молекул ДНК, повреждение через окисление проходит через промежуточных этапы создания свободных радикалов, поэтому этот механизм повреждений ДНК долгое время не замечался. Однако он оказывает сильнейшее воздействие и приводит к серьёзным последствиям, к кожным заболеваниям и к фотостарению. В организме и в коже всегда присутствуют свободные радикалы, они нужны клеткам. Однако под воздействием

UVA лучей в коже генерируется большое количество свободных радикалов.
Лучи UVA проникают гораздо глубже в дерму, чем UVB лучи.
          Энергия UVA лучей поглощается и является генератором свободных радикалов.
Свободные радикалы, они же окислители повреждают молекулы ДНК. Окисленная молекула ДНК, повреждаясь, увеличивает спектр поглощения UV лучей до UVA спектра. Таким образом с этого момента UVA лучи могут напрямую повторно повреждать молекулы ДНК. Стоит вспомнить, что UVA лучи облучают нас круглый год и не зависят от того солнечная погода или нет, находимся мы на улице или в офисе, если есть солнечное освещение то UVA лучи тоже есть.
     

          Окисление протеинов кожи-происходит в результате оксидативного повреждения белков в верхних слоях дермы, которое впоследствии ингибирует протосомальную функцию и способностью клеток разрушать поврежденные протеины

          Фотостарение это длительный процесс накопления фотоповреждений кожи.


          Наша задача используя солнцезащитные фильтры, минимизировать фотоповреждения кожи — а это, в первую очередь ограничение длительности инсоляции, а также правильный подбор одежды. К профилактике фотостарения можно отнести использование  солнцезащитных средств (с маркировкой не менее  SPF 30+, в ряде случаев50+)
          Бороться с фотостарением очень непростая задача, гораздо проще бороться с фотоповреждениями, не допуская их накопления!!!

 

          Коррекция явлений фотостарения кожи должно проводиться под наблюдением врача дерматовенеролога!!!

Рассказов Я.А.

          Получить справочную информацию, а также записаться на процедуру можно по телефону: 956-70-86

Фотостарение: как продлить молодость кожи

Современные методы профилактики и коррекции возрастных изменений основываются на классификации фотостарения по Глогау, которая объединят признаки старения по тем или иным показателям. Такая классификация позволяет составить антивозрастную программу, ориентируясь на типы фотостарения кожи и включает различные омолаживающие методики для стимулирования собственного потенциала клеток.

Таблица фотостарения по (R. Glogau)

Тип 1

Тип 2

Тип 3

Тип 4

  1. Отсутствие или минимально выраженные морщины;
  2. Возраст 20-30 лет
  3. Отсутствие пигментации
  4. Отсутствие кератом
  1. Намечающиеся мимические морщины
  2. Боле заметные мимические морщины при изменении выражения лица
  3. Возраст от 30 до 40 лет
  4. Симптомы фотостарения (от малозаметных до умеренно выраженных)
  5. Ранние сенильные лентиго
  6. Кератомы ощущаются при прикосновении, но визуально малозаметны
  1. Морщины заметны независимо от выражения лица
  2. Возраст от 50 лет
  3. Выраженные симптомы фотостарения
  4. Гиперпигментация и телеангиэктазия
  5. Кератомы и другие доброкачественные новообразования
  1. Глубокие многочисленные морщины
  2. Возраст от 60 лет
  3. Чрезмерно выраженные симптомы фотостарения
  4. Желтоватый цвет лица, многочисленные пигментные пятна
  5. Многочисленные кератомы
  6. Нередко новообразования, в том числе малигнизированные.

Фотостарению наиболее подвержены белокожие и светловолосые люди, с так называемым первым и вторым фототипом кожи. Как правило, они очень быстро обгорают на солнце.

Для предупреждения раннего старения кожи, а также различных кожных заболеваний, спровоцированных солнечными лучами, дерматологи и косметологи настоятельно рекомендуют перед каждым выходом из дома защищать кожу солнцезащитными средствами с фактором защиты не меньше SPF 30. Причем делать это круглогодично. Наносить солнцезащитную косметику необходимо не только на лицо, а также на другие части тела. Кроме того, в жаркое время года нужно носить широкополые шляпы и головные уборы с козырьком, прикрывающим лицо.

Современная косметология помогает улучшить эстетические показатели кожи, активизировать обменные процессы и уменьшить проявления фотостарения. Для этого используют инъекции гиалуроновой кислоты, витаминов, пептидов и факторов роста. Однако лучше предупредить ранее старение с помощью простых и эффективных методов.

Именно для такой «глубокой» защиты косметологами компании ФитоБиоТехнологии совместно с дерматологами была создана линейка  продуктов «Стоп Купероз». В их составе активный запатентованный швейцарский комплекс OCALINE®, который в сочетании с солнцезащитными фильтрами нейтрализует действие вредных солнечных лучей, а также укрепляет стенки капилляров, нормализует кожную микроциркуляцию, увлажняет и успокаивает кожу.

Ежедневный крем SPF30 Стоп Купероз/Stop Cuperoz® – это легкий, насыщенный крем, который содержит натуральный, активно действующий швейцарский комплекс, не содержит парабенов и соответствует международному стандарту GMP (ISO 22716:2007).

Средства серии Стоп Купероз прошли все необходимые лабораторные исследования. Имеют положительный опыт применения на кафедрах дерматологии ряда медучреждений Украины. Рекомендованы к применению при чувствительной или тонкой коже, склонной к эритрозу и куперозу, для ухода за кожей в период восстановления после лазерных процедур, пилингов, а также розацеа.

Свойства:

  • обладает антиоксидантной, противовоспалительной, антиаллергической активностью
  • улучшает питание кожи
  • уменьшает ломкость капилляров
  • устраняет застойные явления в области гиперемии
  • способствует профилактике покраснений кожи
  • снижает эритему
  • нормализует кожную микроциркуляцию
  • укрепляет стенки сосудов
  • защищает от негативного действия ультрафиолета
  • уменьшает проявление «сосудистых звездочек»
  • защищает от UVA/UVB лучей

Помните, что защита от солнца – это профилактика преждевременного старения кожи. Берегите свою молодость и будьте красивы!

Все, что нужно знать про фотостарение (и как его избежать)

Все, что нужно знать про фотостарение (и как его избежать)

Виктория Горб
Врач-косметолог, дерматолог

Старение — это естественный и генетически запрограммированный процесс постепенных изменений внешнего вида нашей кожи и ее функциональных особенностей. Он обусловлен целым рядом внутренних и внешних факторов.

Не стоит забывать о том, что кожа — самый крупный орган нашего тела. Зачастую он отражает все процессы, происходящие в нашем организме. По мере естественного старения (хроностарения), на коже появляются первые морщинки в результате снижения синтеза и коллагена: как результат — она становится менее упругой и тонкой.

Особое внимание стоит уделять и другим фактором, которые способствуют раннему появлению признаков старения, но влияние которых мы можем минимизировать. 

Давно не секрет, что отказ от курения, достаточное количество сна и отдыха, а также низкий уровень стресса благоприятно сказываются как на продолжительности жизни, так и на хорошем состоянии кожи. Простые здоровые привычки продлевают ее красоту и молодость.


Свободные радикалы занимают особое место в нашей жизни, неуклонно ускоряя процессы старения. Их появление провоцирует целый ряд факторов: поллютанты, УФ-излучение, курение (в том числе пассивное), стресс и еще великое множество явлений, нарушающих баланс внутренних систем. Очевидно, что полностью обезопасить себя от их воздействия не удастся, но применение антиоксидантов способно противостоять свободным радикалам, снизив их активность, и уменьшить последствия влияния на кожу и организм в целом.

Воздействие ультрафиолетового излучения имеет наиболее пагубное влияние на красоту и молодость кожи. Это явление и называется фотостарением, которое проявляется в виде преждевременного появления морщинок, снижения тургора кожи, выраженной сухости кожи, расширения капилляров и появления пигментных пятен.

Для замедления данного процесса необходимо помнить о таких простых правилах: избегайте прямых солнечных лучей в часы повышенной солнечной активности (с 11:00 до 16:00) и используйте солнцезащитные средства не только летом, но и круглый год. Ультрафиолетовые лучи способны проникать даже через облака и стекла, поэтому важно защищать свою кожу и зимой.

При подборе солнцезащитного средства необходимо учитывать, что оно должно не только обеспечивать полноценную защиту от UVA и UVB лучей, но и поддерживать состояние эпидермального барьера, увлажнять и успокаивать кожу.

Среди огромного количества представленных сегодня средств, направленных на борьбу с ультрафиолетовым излучением, защитная линия бренда Ultraceuticals имеет ряд преимуществ.

Напомним, что место рождения бренда — Австралия, страна с особыми климатическими условиям и круглогодичным воздействием агрессивных и опасных солнечных лучей. Эффективность и безопасность солнцезащитных средств контролируется не только самим производителем, но и государством. После многоэтапной проверки независимых лабораторий каждому продукту присваивается свой регистрационный номер AUST L, что гарантирует полное соответствие государственным стандартам качества.

В составе каждого продукта линии защиты бренда Ultraceuticals мы обнаружим не только безопасные и эффективные UVA и UVB фильтры, но и такие компоненты, как масло ши, гиалуроновая кислота, ниацинамид и пантенол: они направлены на увлажнение, смягчение и восстановление кожи. 


Австралийцы также особое внимание уделяют текстурам, гарантируя комфорт в ежедневном использовании, не допуская ощущений «маски» и «пленки» на поверхности кожи. Напротив, были разработаны формулы, которые дают возможность каждому типу кожи подобрать наиболее подходящую. 

Обладателям комбинированной или жирной кожи рекомендуется использовать защитный крем с матирующим эффектом — например, Ultra UV Protective Daily Moisturiser SPF 30 Mattifying или Ultra UV Protective Daily Moisturiser SPF 50 Mattifying от Ultraceuticals

Если кожа нуждается в дополнительном увлажнении, свой выбор следует сделать в пользу защитного увлажняющего крема с эффектом гидратации: Ultraceuticals Ultra UV Protective Daily Moisturiser SPF30 Hydrating или Ultra UV Protective Daily Moisturiser SPF50 Hydrating.

Что такое фотостарение кожи лица.

Под воздействием разрушительного действия внешних факторов естественный защитный слой нашего тела – кожа стареет быстрее, чем остальные органы.

Фотостарение кожи, прогрессирующее с возрастом, зависит от многих внутренних (генетика, гормоны) и внешних причин.

Последствия фотостарения

Длительное воздействие солнечного излучения может усугубить многие неблагоприятные изменения в структуре, функциях и внешнем виде кожи. Такие процессы называют фотостарением. Накопление ультрафиолетовых лучей, дополнительно усиленное другими факторами окружающей среды, вызывает множество негативных изменений, видимых на коже, особенно на лице, шее или руках.

  • На коже видны глубокие морщины и борозды, сухость, шероховатость, изменение цвета, а также потеря эластичности кожи.
  • На незащищенной коже в результате повреждения ДНК возникает актинический кератоз, а также рак кожи, в том числе меланома.
  • Наиболее характерным явлением является эластоз, вызывающий накопление аномальных масс эластина в коже.
  • Также наблюдается дегенерация коллагеновых волокон и их сокращение.
  • Все это приводит к образованию глубоких морщин, дряблости кожи.

Кроме того, размножение и повреждение меланоцитов приводит к изменению цвета, веснушкам или пятнам. Чрезмерное пребывание на солнце может спровоцировать рост сальных желез и образование кист, что приводит к образованию черных точек.

Основные проявления фотостарения кожи – это раннее появление морщин. В этом случае очень легко получить мимические морщинки на лбу или возле глаз. Заметно изменение качества кожи. Она становится менее эластичной, становится тонкой и сухой. Появляются веснушки, пигментация или изменение цвета.

Менее известные и менее частые изменения в нашем организме, которые происходят после воздействия УФ-излучения:
  • фотодерматит,
  • пеллагра,
  • ослабление иммунной системы,
  • фототоксический и фотоаллергический дерматит,
  • летняя чесотка,
  • солнечная крапивница,
  • хронические солнечные изменения.

Методы коррекции и лечения фотостарения кожи

О профилактике нужно помнить каждый день. Поэтому кремы для лица с уф-защитой следует использовать каждый день, а летом – наносить защитные средства на все тело.

Помните, что когда мы загораем и принимаем солнечные ванны, мы должны наносить водостойкие эмульсии. Кремы наносят минимум за 30 минут до планируемого выхода на солнце.

Для лечения фотостарения кожи также важно правильное питание и витамины. Здесь могут пригодиться витамин С или коллаген. Оба эти ингредиента могут быть представлены в форме таблеток. Также можно делать специальные маски, в состав которых входят эти вещества. Они улучшат внешний вид кожи, закроют кровеносные сосуды и помогут избавиться от свободных радикалов, вызывающих преждевременное старение кожи.

Однако часто бывает, что в молодости мы не думаем о том, как защитить кожу. В этом случае косметические процедуры помогают избавиться от воздействия УФ-излучения. К ним относятся:

  1. химический пилинг,
  2. лазерные процедуры,
  3. гиалуроновая кислота,
  4. фотоомоложение с помощью IPL.

Существует и много других процедур, которые эффективно позаботятся о состоянии вашей кожи, придав ей красивый и свежий вид.

Цена идеального загара – фотостарение

При старении часто появляются мимические морщины и неравномерная пигментация кожи. Естественное старение – сравнительно медленный процесс, записанный в нашей ДНК. К сожалению, воздействие внешних факторов, образ жизни и общее состояние здоровья ускоряет процесс старения, и изменения на лице заметны уже после возраста 20 лет. Хотя в этом нежелательном процессе мы обычно виним течение времени, главная причина преждевременных изменений кожи другая. 

В 90% появляющихся со временем визуальных изменений кожи виновато ФОТОСТАРЕНИЕ!

Фотостарение – это процесс, при котором под воздействием УФ-излучения в коже начинается преждевременное разрушение коллагена и блокируется синтез нового коллагена. Кожа становится более сухой, образуются первые морщины, которые со временем становятся глубже. Фотостарение влияет не только на эстетический вид кожи, но и на ее барьерные функции, терморегуляцию и чувствительность. Следы этого процесса явно видны в местах, которые чаще всего подвергаются воздействию УФ-лучей – на лице, губах, руках, на шее и в зоне декольте.

Усиленному воздействию солнца подвержены люди, проживающие или длительное время отдыхающие в тропических и субтропических странах и на высокогорьях, а также те, кто большую часть недели проводит в помещении (офисе) и затем за короткий период времени подвергает себя интенсивному воздействию солнца, длительно находится на солнце или работает на открытом воздухе.

Признаки фотостарения:

  • «Гусиные лапки», глубокие борозды вокруг глаз и рта,
  • Морщины, которые обычно видны, когда человек морщит лоб, а также хорошо видны, когда лоб не наморщен,
  • Пигментация кожи: веснушки, «возрастные пятна», неравномерный цвет кожи,
  • Появление капиллярного рисунка на носу, щеках или шее,
  • Сухость и шелушение кожи,
  • Красноватые, сухие, шелушащиеся участки кожи (актинический кератоз),
  • Желтоватый оттенок кожи.

Только одно решение

Фотостарение можно замедлить и предотвратить, следуя только одному профилактическому совету – избегать чрезмерного воздействия УФ-лучей.

  • Не посещайте солярий,
  • Воздержитесь от чрезмерного загара, а также не загорайте с 11.00 до 16.00,
  • Постоянно используйте защитный крем от солнца (не менее SPF 20),
  • Носите подходящую одежду, защищающую от солнца.

Еще раз про защитные средства от УФ-лучей

Защитные средства не должны быть липкими, неприятными или сложными в нанесении. Сейчас доступны качественные, дерматологически и офтальмологически проверенные средства в виде спреев, карандашей (губы, зона век) и легких лосьонов, которые не мешают и гораздо лучше защищают кожу. Кожу от ультрафиолетового излучения необходимо защищать и в облачную погоду! Специализированная косметика Anti-aging содержит и защитный элемент от УФ-лучей, который делает защиту незаметной ежедневной составляющей, а не дополнительной обязанностью.

  • Используйте защитное средство с SPF 30, для очень светлой кожи – SPF 50, если планируете находиться на солнце более 20 мин.
  • Используйте защитное средство с SPF 50 после дерматологических или косметических процедур. 
  • Чтобы защитные средства успели подействовать, наносите их за 15-20 минут до выхода на солнце.

Хотя ассортимент защитных средств обширный, наиболее надежную и удобную защиту от УФ-излучения обеспечат препараты, прошедшие медицинскую проверку.

Устранение последствий

Если фотостарения не удалось избежать, и оставленные солнцем следы вызывают дискомфорт, состояние кожи можно улучшить.

После консультации с врачом можно использовать различные методы:

  • Трофические средства,
  • Химические пилинги,
  • Дермабразия и микродермабразия,
  • Филлеры и инъекции токсина ботулина,
  • Лазерные процедуры.

Однако устранение имеющихся визуальных дефектов не означает, что мы защищены от них и в будущем! Процедуры и средства эстетической медицины позволяют исправить допущенные ошибки, а ответственная практика Anti-Aging – возможность их больше не повторять. Будем красивыми, здоровыми и ответственными!

Видео: Истинные следы, оставленные солнцем
https://www.youtube.com/watch?v=o9BqrSAHbTc&list=PL66t0qB1o_AjFx8AUYcGfwWRrKKrNzm1_

Фотостарение кожи | Прима Медика

Фотостарение кожи

Безопасно ли загорать? Какие реакции возникают на коже под воздействием УФ-излучения?

Загорелый оттенок кожи всегда ассоциируется со здоровьем и успехом, скрывает определенные дефекты. При этом загар провоцирует старение кожи. Мало кто задумывается о том, что загар это следствие повреждения кожи лучами солнца, а выработка меланина это ее защитная реакция.

Как действуют УФ-лучи на кожу?

Ультрафиолетовое излучение стимулирует выработку свободных радикалов в коже, они повреждают клетки.

УФ–лучи проникают в глубокие слои кожи, повреждается ДНК клеток, в следствии чего образование эластина и коллагена замедляется, кожа теряет эластичность и упругость, появляется неоднородность текстуры.

Помимо этого, свободные радикалы рузрушают тот коллаген, который уже есть в коже, уменьшается эластичность сосудов, нарушается кровообращение, поверхностный слой кожи утолщается.

Все эти вышеперечисленные факторы и приводят к преждевременному старению кожи.

Последствия воздействия УФ-излучения

  • увеличение пор кожи
  • увеличение угревых высыпаний
  • нарушение естественной пигментации (истощение восстанавливающей способности кожи)
  • расширение капилляров (телеангиоэктазии)
  • формирование купероза

Лечение фотостарения кожи

Чаще всего, к огромному сожалению врачи косметологи занимаются уже лечением изменений кожи, а не профилактикой.

Для лечения последствий наиболее эффективными являются химические пилинги, аппаратные методы (ультразвук, микротоки, фототерапия и др. ) мезотерапия, витаминотерапия.

В нашем медицинском центре «Прима Медика» (м.Калужская) врачи-косметологи помогут Вам решить эту проблему. Цену уточняйте в разделе Услуги и цены.

участники проекта «Московское долголетие» из ЗАО занимаются фейсфитнесом

С октября прошлого года в рамках проекта «Московское долголетие» жители запада Москвы имеют возможность посещать онлайн-занятия по фейсфитнесу.

Что представляет из себя фейсфитнес и можно ли замедлить старение кожи? Клуб здорового питания Юлии Артемовой делится с читателями «НЗМ» полезной информацией.

Что такое фотостарение

Фотостарение – это преждевременное проявление признаков старения кожи, вызванное воздействием ультрафиолетовых лучей. Существует 2 типа лучей: UVB – отвечает за загар и солнечные ожоги; UVA – оказывает пагубное воздействие в глубоких структурах. Под их воздействием происходит: повреждение всех жизненно важных структур эпидермиса; разрушение эластина, ведущее к застою в капиллярах и воспалительным процессам; нарушение выработки коллагена и гиалуроновой кислоты – основ упругости кожи; неравномерное утолщение кожи, появление заломов и морщин.

Как же с этим бороться? В активные солнечные часы не находиться под открытым небом даже в пасмурную погоду; не злоупотреблять посещением солярия; не загорать слишком долго под солнцем; пользоваться косметикой и кремами с SPF — это средства защиты от УФ-лучей.

Если вы уже видите последствия после нахождения на солнце, у вас неоднородный цвет лица, появилась сосудистая сетка, потеря упругости, тонуса и эластичности кожи, всё это можно исправить.

Как работает фейсфитнес

— Фейсфитнес — это тренировка мышц лица. Занятие начинается с разминки, где мы работаем с осанкой, затем переходим к проработке всей мускулатуры — 57 мышц, находящихся на голове: лоб, глаза, нос, скулы, щёки, подбородок, шея. Результатом программы является омоложение. Кто-то морщит брови, кто-то приподнимает их, в зависимости о нашей мимики у нас появляются мимические морщины. Мы сокращаем мышцы, они становятся спазмированными. На тренировках мы их расслабляем, стремимся к их первоначальной природной форме, — объясняет руководитель направления «Фейсфитнес» Александра Панюшкина. — Щёчные, скуловые мышцы у людей старшего возраста часто бывают расслаблены, овал лица плывёт, становятся выраженными брыли. Мы подтягиваем, тонизируем эти мышцы, чтобы щёчки были, как наливные яблочки. Плюс к этому мы улучшаем кровоснабжение, питание, лимфодренаж. Соответственно, уходит отёчность, мешки, круги под глазами, подтягивается зона второго подбородка, шея, кожа тоже становится лучше — более сияющей и с ровным тоном.

Результаты на лицо и на лице

Раз в триместр устраивается конкурс среди участников направления. Они делают фотографии до начала тренировок и после. Светлана Коплик стала победительницей в группе района Внуково в первом триместре.

— Межбровье разгладилось, лоб стал глаже, глаза приоткрылись, верхнее веко приподнялось, у нижнего морщин не заметно, носогубные складки сгладились, морщин у рта заметно поубавилось, овал лица подтянут, кожа лица приобрела здоровый оттенок, — делится своими результатами Светлана Викторовна. — Изменения видны. Буду продолжать совершенствоваться.

Кроме этого, женщина подчёркивает, что даже состояние волос улучшилось, и седины стало меньше.

Занятия проходят 2 раза в неделю на платформе Zoom. Александра рассказывает, что по видео она следит за правильностью выполнения упражнений. Уроки рассчитаны на год. Каждый триместр вводится новая программа упражнений.

— Конечно, в основном, по этому направлению занимаются женщины, из 8 групп только в половине есть по одному мужчине, — улыбается Александра. — Но есть и такие случаи, когда приходит заниматься мужчина, а потом к нему присоединяется и его жена.

Александра Панюшкина преподаёт фейсфитнес с 2015 года. Она ведёт группы районов Дорогомилово и Внуково. Раньше она работала фитнес-инструктором и увлекалась психологией.

— Хочу поблагодарить Александру за её профессионализм. Её доброжелательная энергетика зарядила группу позитивным настроем. Я прозанималась почти полгода, результат — на лице! Замечаю, что все мы, посещающие тренировки, помолодели, — подчёркивает Наталья Ибрагимова. — А самое приятное, что у нас появился блеск в глазах.

Сейчас в Московском долголетии работают 87 групп по этому направлению. Запись на занятия проводится в Центрах социального обслуживания Москвы или по телефону 8(495) 180-49-50.

— Екатерина Магдыч Фото: mos.ru, из личного архива Александры Панюшкиной

границ | Антифотостарение и противовоспалительное действие гинзенозида Rk3 при воздействии УФ-излучения

Введение

Кожа человека будет больше подвергаться солнечному ультрафиолетовому (УФ) излучению из-за истощения озонового слоя (Gromkowska Kępka et al., 2021; Lyons). и др., 2021). Хотя многие ученые изо всех сил пытались замедлить, остановить или обратить вспять разрушение озонового слоя, например, путем сокращения выбросов хлорфторуглеродов, этот процесс восстановления требует нескольких лет или даже десятилетий (Krutmann and Berneburg, 2021).Поэтому мы должны сосредоточиться на использовании существующих ресурсов для лечения или предотвращения повреждений, вызванных УФ-излучением (Sambandan and Ratner, 2011; Huang and Chien, 2020). Фотостарение является одной из основных причин повреждений от длительного УФ-излучения, и его очень трудно избежать в повседневной жизни (Poon et al., 2015). Воздействие ультрафиолета вызывает появление морщин на коже, фотостарение, высыхание, шероховатость, отсутствие эластичности и меланогенез. В тяжелых случаях это может даже привести к раку кожи (Sander et al., 2021).

Эксперименты на животных показали, что кожа мышей выглядела морщинистой, утолщенной и окрашенной после длительного воздействия УФ-излучения (Gromkowska Kępka et al., 2021). Наблюдалось резкое снижение эластичности кожи, содержания воды и содержания коллагена (измеренное с помощью гидроксипролина (HYP)) (Petruk et al., 2018). Окисление липидов является еще одним важным признаком старения организма и состоит из очень сложного набора свободнорадикальных реакций (Petruk et al., 2018; Chen et al., 2020). Супероксиддисмутаза (SOD) и глутатионпероксидаза (GSH-Px) представляют собой цитозольные ферменты, которые могут восстанавливать пероксидные радикалы и защищать организмы от окислительного повреждения (Kammeyer and Luiten, 2015; Nanda and Madan, 2021).Следовательно, здоровье кожи должно соответствовать активности SOD и GSH-Px в сыворотке (Pandel et al., 2013; Nanda and Madan, 2021). Напротив, уровень малонового диальдегида (МДА), который является продуктом окисления липидов, повышен (Pandel et al., 2013). Экспрессия матриксной металлопротеиназы (ММП) является еще одним индикатором старения кожи (Duan et al., 2019; Lee et al., 2021). Высокая экспрессия ММП ускоряет деградацию внеклеточного матрикса в дерме и повреждает соединительную ткань кожи (Pittayapruek et al., 2016; Сяо и др., 2020). С другой стороны, кожа как самостоятельный иммунный орган подвергается воздействию УФ-излучения и вызывает воспалительные и иммунные реакции (Kandan et al., 2020). Интерлейкин 1 (IL-1), интерлейкин 6 (IL-6) и фактор некроза опухоли α (TNF-α) являются тремя важными цитокинами в тканях кожи, которые могут инициировать и регулировать воспаление кожи, приводя к локальному воспалению кожи. Ли и др., 2019 г.; Ке и Ван, 2021 г.). Предыдущее исследование показало, что УФ-излучение вызывает образование активных форм кислорода (АФК) и ускоряет окисление липидов, что приводит к световому повреждению клеток и ДНК (Serafini et al., 2015; Брем и др., 2017). Более того, АФК также способствуют синтезу и секреции ИЛ-1, ИЛ-6 и ФНО-α. Таким образом, уровни ИЛ-1, ИЛ-6 и ФНО-α можно использовать для отражения степени повреждения, вызванного УФ-излучением (Poon et al., 2015; Fuller, 2019).

Женьшень ( Panax ginseng Meyer) — полезная трава, которая широко культивируется в Корее и Китае и веками использовалась для профилактики и лечения различных заболеваний (Wong et al., 2015; Liu and Fan, 2019). ).Гинзенозиды являются основными активными компонентами женьшеня (Wong et al., 2015). Известно, что в физиологии кожи гинзенозиды регулируют пигментацию и оказывают омолаживающее действие (Nam et al., 2017; Liu et al., 2018). Было обнаружено, что гинзенозид Rg1 усиливает меланогенез и активность тирозиназы в меланоцитах человека (Gao et al., 2010). Напротив, гинзенозид F1, который является метаболитом гидролиза Rg1, может ингибировать видимую пигментацию (Han et al., 2014). Гинзенозиды состоят из многих компонентов, таких как гинсенозиды 20(S)-Rg3, 20(R)-Rg3, Rk3, Rh5, Rk1 и Rg5 (Xu et al., 2016). За исключением Rg1, свойства других компонентов менее изучены. Гинзенозид Rk3 представляет собой разновидность природных активных компонентов женьшеня, который вот уже 100 лет используется в качестве функционального продукта питания и лекарственного средства во многих странах (Xu et al., 2016).

В этом исследовании особое внимание было уделено влиянию редкого природного гинзенозида Rk3 на ингибирование фотостарения и воспалений кожи мышей, вызванных УФ-облучением. Гинзенозид Rk3 смешивали с кремом, который можно было использовать в качестве солнцезащитного средства.Этот крем наносили на кожу мыши, которая затем подвергалась воздействию УФ-А и УФ-В-излучения. Затем контролировали состояние кожи мышей и проводили патологический анализ кожи мышей для изучения изменений коллагеновых волокон. Для оценки антифотостарения и противовоспалительных свойств гинсенозида Rk3 было измерено несколько важных параметров, включая эластичность кожи, содержание воды, активность SOD и GSH-Px, а также HYP, MDA, MMP, IL-1, IL-6 и Уровни TNF-α.

Материалы и методы

Материалы

Куньминские мыши были приобретены в Военно-медицинском университете ВВС НОАК (Сиань, Китай).Гинзенозид Rk3 (≥98%) был получен от Xi’an Giant Biogene Technology Co., Ltd. Соответствующий процесс приготовления описан в нашем предыдущем исследовании (Qu et al., 2019). Химическая структура гинзенозида Rk3 показана на рисунке 1. Гинзенозида Rk3 смешивали с кремом для изготовления солнцезащитного средства. Этот продукт был выпущен нашей группой (Xi’an Giant Biogene Technology Co., Ltd.) и зарегистрирован как «Shan G Zhuang Wang Bei Zi 20133 (китайский: 陕G妆网备字20133)» в Китае. Подробную информацию можно найти в нашем опубликованном патенте (CN 202010419961.1). В этом исследовании крем G-Rk3 использовался для представления этого запущенного солнцезащитного крема. Другой солнцезащитный крем был приготовлен таким же образом, но без добавления гинзенозида Rk3 (обычный крем). УФ-лампа мощностью 40 Вт с основным гребнем 340 нм и УФ-лампа мощностью 40 Вт с основным гребнем 313 нм были приобретены у компании Kunshan Laibang Instrument Company (Китай). Исследование на животных было рассмотрено и одобрено Комитетом по этике животных Северо-Западного университета (NWN-AWC-20210357M).

РИСУНОК 1 . Химическая структура гинзенозида Rk3.

Фотостарение кожи мыши

Солнечные ультрафиолетовые лучи обычно состоят из длинноволнового УФ-А и средневолнового УФ-В, но не коротковолнового УФ-С. Поэтому для имитации УФ-облучения одновременно использовались UVA и UVB. Волосы в области 3 × 4 см 2 на спине каждой мыши удаляли. Расстояние облучения контролировалось на уровне 10 см. Воздействие проводили один раз в 2 дня в течение первой недели и один раз в день в течение остальных недель. Этот процесс облучения повторяли в течение 12 недель.За здоровьем мышей следили. Если наблюдались язвы или волдыри, облучение приостанавливали на 2 дня.

40 Мышей Куньмин разделили на четыре группы. Перед фотостарением всех мышей смазывали инсульт-физиологическим раствором в течение 1 недели. Группа I была контрольной, мыши этой группы смазывались тридистиллированной водой и не подвергались никакому УФ-облучению. Группы Ⅱ (группа модели фотостарения), Ⅲ и IV смазывались тройной дистиллированной водой, нормальным кремом и кремом G-Rk3 соответственно.Затем через 1 час всех мышей облучали. Для измерения модуля упругости кожной ткани мышей использовали универсальную испытательную машину (Instron Corporation, США). Патологические образцы были отправлены в Военно-медицинский университет ВВС (Сиань, Китай) для анализа. Наборы для твердофазного иммуноферментного анализа (ELISA) использовались для измерения активности SOD и GSH-Px, а также уровней HYP, MDA, MMPs, IL-1 и IL-6.

Оценка восстановления после растяжения

Перед щипковым тестированием мышей анестезировали.Кожу спины по средней линии поднимали пальцами до тех пор, пока животное не поднимали в воздух и не удерживали в течение 3 с. Затем мышей помещали на землю. Регистрировали время восстановления кожи до ее исходного состояния.

Оценка содержания воды

Мышей забивали путем смещения шейных позвонков, сразу же собирали их спинную кожу (без подкожного жира) и хранили при -20°C. Ткань взвешивали до и после сушки для расчета содержания воды в коже.

Оценка перекисного окисления липидов

Для оценки перекисного окисления липидов использовали три важных показателя: активность СОД и уровни GSH-Px и MDA. У мышей собирали орбитальную кровь. Собранную кровь быстро центрифугировали при 1°С и хранили при -20°С. Активность СОД, уровни GSH-Px и МДА измеряли соответствующими наборами (Nanjing Jiancheng Bioengineering Institute, Китай).

Приготовление гомогенатов кожи

Кожу мыши (0,5 г) подвергали криоконсервации при -80°C и дважды промывали предварительно охлажденным физиологическим раствором.Для очистки поверхности кожи использовали фильтровальную бумагу. Кожу мыши помещали в предварительно охлажденную пробирку для ВП и добавляли 4,5 мл физиологического раствора. Гомогенизатор (HomoLab, FBF Co., Италия) использовали при низкой температуре. Полученный раствор проверяли на отсутствие интактных клеток. Полученный гомогенат центрифугировали при 1°С. Супернатант собирали для дальнейшего анализа.

Уровни MMP

Супернатант гомогенатов кожи использовали для анализа уровней MMP-1 и MMP-3 с использованием наборов ELISA (Shanghai Enzyme-Linked Biotechnology Co.ООО, Китай).

Оценка коллагена кожи

HYP является одним из основных компонентов коллагена кожи, составляющим примерно 13,5% коллагена млекопитающих. Как правило, уровень HYP должен быть стабильным в здоровом состоянии, и это можно использовать для представления уровня коллагена. HYP измеряли с помощью соответствующих наборов HYP (Nanjing Jiancheng Bioengineering Institute, Китай).

Оценка воспаления кожи

ИЛ-1, ИЛ-6 и ФНО-α являются тремя важными цитокинами в тканях кожи (Lee et al., 2019). Эти цитокины являются важными триггерами для запуска и регулирования воспаления кожи и были проанализированы с помощью ELISA (Shanghai Enzyme-Linked Biotechnology Co., Ltd., Китай).

Для каждого параметра (включая эластичность кожи, содержание воды, активность SOD и GSH-Px, а также уровни HYP, MDA, MMPs, IL-1, IL-6 и TNF-α) относительная разница составила рассчитывается следующим образом:

Относительная разница = группа X− группа I группа I × 100% (1)

В уравнении 1 группа X представляет значение каждого параметра в группах Ⅱ, Ⅲ или IV.

Эффективность улучшения была определена как решающий показатель для оценки нормального крема и крема G-Rk3.

Эффективность улучшения обычного крема рассчитывали следующим образом:

Повышение эффективности обычного крема = группа II − группа IIIгруппаIII×100%.(2)

В уравнении 2 группа II и группа III представляют собой значение относительной разницы параметр в каждой группе.

Эффективность улучшения крема G-Rk3 рассчитывали следующим образом:

Улучшение эффективность крема G-Rk3=группаII−группаIVгруппаIV×100%.(3)

В уравнении 3 группа II и группа IV представляют значение относительной разницы параметра в каждой группе.

Эффективность улучшения крема G-Rk3 по сравнению с обычным кремом рассчитывали следующим образом: IV представляют собой значение относительной разницы параметра в каждой группе.

Результаты и обсуждение

Макроскопическая оценка кожи спины

Старение — медленный процесс.Кожа, являющаяся самым внешним барьером, играет очень важную роль в предотвращении воздействия ультрафиолетовых лучей, температуры, влажности и т. д. (Lai-Cheong and Mcgrath, 2017). Среди этих факторов фотостарение, вызванное УФ-облучением, является наиболее серьезным фактором, связанным со старением кожи (Brem et al., 2017). Поэтому было исследовано влияние гинзенозида Rk3 на ингибирование фотостарения и воспаления.

На рис. 2А показана контрольная группа, представляющая здоровую кожу мыши. Как показано на рисунке 2B, модель фотостарения была создана путем УФ-облучения ткани кожи мыши.Через 2 недели на коже в группе моделей фотостарения наблюдались морщины, кожа демонстрировала легкое покраснение и выглядела впалой. При этом кровеносные сосуды идентифицировать было легче, чем в других группах. Через 6 недель наблюдались явные морщины и впалый вид. Вся кожа выглядела очень тусклой. Наблюдались четкие следы солнечных ожогов, которые могли быть вызваны разрывом капилляров. Через 12 недель состояние кожи мышей в группе Ⅱ было очень плохим. На большом участке кожи наблюдались значительные язвы и волдыри.В группе Ⅲ для предотвращения фотостарения использовали обычный крем без гинзенозида Rk3, как показано на рисунке 2C. По сравнению с группой 2 состояние кожи несколько улучшилось. После УФ-облучения в течение 2 недель наблюдались небольшие морщины и впалый вид, но покраснения не наблюдалось. Через 6 недель наблюдались морщины и впалый вид. Кожа мыши постепенно становилась тусклой и теряла эластичность. Хотя явных следов солнечных ожогов не наблюдалось, на этой стадии стало легко идентифицировать кровеносные сосуды на спине.Через 12 недель состояние кожи мышей в группе Ⅲ также было очень плохим. Невооруженным глазом наблюдалась значительная потеря кожной ткани. На больших участках кожи наблюдались выраженные язвы и волдыри.

РИСУНОК 2 . Макроскопическая оценка кожи спины. УФ-облучение в течение 2 недель (A) ; 6 недель (В) ; и 12 недель (C) .

Несмотря на то, что в группе Ⅱ наблюдались серьезные язвы и волдыри, состояние кожи в группе IV значительно улучшилось благодаря использованию крема G-Rk3.Как показано на рисунке 2D, кожа мышей выглядела гладкой и упругой даже под УФ-облучением в течение 12 недель. Во всех случаях наблюдалось очень мало морщин. В этой группе язв и волдырей не наблюдалось; таким образом, УФ-облучение никогда не прекращалось. Теоретически время облучения в группе IV было самым продолжительным среди групп. За исключением гинзенозида Rk3, обычный крем и крем G-Rk3 содержат одни и те же ингредиенты. Таким образом, гинзенозид Rk3 играет очень эффективную роль в подавлении фотостарения и воспаления.

Оценка восстановления после растяжения

Эластичность кожи — комплексный показатель, отражающий здоровье кожи (Lai-Cheong and Mcgrath, 2017). На рис. 3А показано время восстановления кожи мышей после лифтинга, что является важным индикатором фотостарения. После УФ-облучения в течение 2 недель анализ SPSS показал, что между четырьмя группами не было очевидной разницы ( p > 0,05). Через 6 недель в группе Ⅱ наблюдалась значительная разница ( p < 0.05), предполагая, что была создана успешная группа моделей фотостарения. Более того, группа Ⅲ также показала значимое различие по сравнению с группой I (90 009 p 90 010 < 0,05), но не значимое различие по сравнению с группой 2 (90 009 p > 0,05). Хотя обычный крем немного защищал кожу мышей, он не мог замедлить или остановить процесс фотостарения, а скорости фотостарения в группах Ⅱ и Ⅲ были очень схожими (рис. 2, 3). Таким образом, обычный крем не обладал свойствами против фотостарения.После УФ-облучения в течение 12 недель степени фотостарения в группах Ⅱ и Ⅲ были очень тяжелыми и не показали существенных различий ( p > 0,05), но их фотостарение значимо отличалось от такового в группе I ( p ≈ 0,018). Как показано на рисунке 3B, периоды восстановления в этих двух группах были на 235 и 217% выше, чем в группе I, соответственно. По сравнению с трижды дистиллированной водой эффект антифотостарения обычного крема увеличился на 8%, как показано на рисунке 3C.Напротив, эффекты фотостарения в группах I и IV не показали каких-либо существенных различий ( p > 0,05), что указывает на то, что эластичность кожи сохранялась при применении крема G-Rk3. Время восстановления увеличилось только на 48%. Антифотостарение крема G-Rk3 резко увеличилось на 79% по сравнению с тридистиллированной водой, что было в 3,5 раза выше, чем у обычного крема.

РИСУНОК 3 . Оценка восстановления после растяжения.Время восстановления (А) . Использовали абсолютное значение времени восстановления в исходном состоянии (0 недель). В другие недели отображается только прирост за 2 недели. # Достоверно отличается от группы I, p < 0,05. * Не отличается от группы I, р > 0,05. Относительные различия в четырех группах (B) . Повышение эффективности обычных кремов и кремов G-Rk3 (C) .

Окрашивание кожи мышей гематоксилином и эозином

Гистологическим признаком фотостарения является кожный эластоз, который в основном состоит из утолщенных, спутанных и, в конечном счете, зернистых аморфных эластичных структур (Rittié and Fisher, 2015).Длительное УФ-облучение может повредить дермальные фибробласты, что приведет к аномальному эластину или перевариванию внеклеточного матрикса, вызванному медиаторами воспаления (Kandan et al., 2020). Типичное фотостарение кожи может характеризоваться эпидермальной гиперплазией, дермальным эластозом, деградацией белков матрикса и перивенулярными лимфогистиоцитарными инфильтратами дермы. После УФ-облучения в течение 12 недель мы исследовали характерные гистологические особенности эпидермиса и дермы. Анализ окрашивания гематоксилином и эозином (H&E) различных групп показан на рисунке 4.Нормальная контрольная группа I и группа IV показали сходные черты. Эпидермис имел несколько очевидных слоев плоскоклеточных клеток, которые были покрыты тонким слоем кератина и определенными клетками зернистого слоя. Под базальным слоем наблюдается базальная мембрана. При этом коллагеновые волокна и волокна эластической ткани концентрировались на поверхностных слоях дермы. Скопления сальных желез прикреплялись к волосяным фолликулам, а потовые железы преимущественно располагались на поверхностных слоях дермы. В более глубоких слоях дермы обнаруживались обильные жировые отложения с регулярно расположенными волосяными фолликулами; сосудистые каналы также были равномерно распределены.Кожа мышей, которым вводили крем G-Rk3 (группа IV), имела такое же состояние, как и в контрольной группе I. Незначительное отличие наблюдалось только в базальной мембране. У мышей IV группы наблюдали несколько припухшие и нечетко размытые участки кожи. Однако воспаления не обнаружено. Этот патологический анализ показал, что гинзенозид Rk3 в качестве ингредиента крема может значительно уменьшить или почти устранить фотостарение, вызванное УФ-облучением.

РИСУНОК 4 .Окрашивание кожи мышей гематоксилин-эозином.

Кожа мышей в группе фотостарения Ⅱ была сильно обожжена, а толщина эпидермиса резко уменьшилась. Состояние кожи мышей, которым вводили обычный крем (группа Ⅲ), немного улучшилось, но также имело черты, сходные с таковыми в группе Ⅱ. В области эпидермиса наблюдался выраженный клеточный пикноз. Эпидермис резко утолщен, что связано с нечеткостью базальной мембраны и врастанием в дермальный коллаген.Роговой слой отслоился, обнажив эпидермис, место соединения эпидермиса и дермы уплощено, дермальный сосочек и эпидермальные выпячивания исчезли. Многие эластические ткани и коллагеновые волокна были разрушены, а остальные также демонстрировали крайнюю дезорганизацию и распределение. Кроме того, в дерме между жировыми клетками и волосяными фолликулами наблюдались отек и воспаление, а капилляры были перегружены или даже повреждены. Таким образом, обычный крем не защищал кожу мышей от фотостарения.Эти патологические результаты свидетельствуют о том, что гинзенозид Rk3 является эффективным ингредиентом против фотостарения для защиты кожи от УФ-излучения.

Оценка содержания воды

Содержание воды в кожной ткани играет очень важную роль в поддержании эластичности кожи (Pangestuti et al., 2021). Потеря содержания воды является одним из признаков старения, а УФ-облучение может ускорить этот процесс, что приводит к фотостарению кожи. Как показано на Фигуре 5, гравиметрический метод был использован для анализа содержания воды в тканях кожи мышей в четырех группах после УФ-облучения в течение 12 недель.По сравнению с группой I содержание воды в коже в группах Ⅱ и Ⅲ значительно уменьшилось ( p < 0,01). Степень снижения в обеих этих группах достигала примерно 30%. Однако в коже мышей, смазанных кремом G-Rk3, потеря воды составила всего 2,4% (группа IV). Этот вывод свидетельствует о том, что группа IV не показала существенных отличий от группы I ( p > 0,05). По сравнению с тройной дистиллированной водой эффективность увлажнения обычного крема увеличилась только в 3 раза.2%, а у крема G-Rk3 резко увеличилась на 92%. Таким образом, эффективность увлажнения крема G-Rk3 заметно улучшилась и стала в 28,5 раз выше, чем у обычного крема. Единственным отличным ингредиентом между обычным кремом, используемым в группе Ⅲ, и кремом G-Rk3, используемым в группе IV, был гинзенозид Rk3. Таким образом, гинзенозид Rk3 обладает превосходными увлажняющими свойствами для кожи.

РИСУНОК 5 . Оценка содержания воды. Абсолютное значение содержания воды (А) .##Очень значимо отличается от группы I, p < 0,01. * Не отличается от группы I, р > 0,05. Относительные различия в четырех группах (B) . Повышение эффективности обычных кремов и кремов G-Rk3 (C) .

Оценка перекисного окисления липидов

Окисление липидов является еще одним важным признаком старения организма и состоит из очень сложного набора свободнорадикальных реакций (Petruk et al., 2018; Chen et al., 2020). СОД, как важная антиоксидантная защита почти во всех живых клетках, может избирательно катализировать дисмутацию (или разделение) радикалов супероксида на обычный молекулярный кислород и пероксид водорода (Kammeyer and Luiten, 2015; Nanda and Madan, 2021).Таким образом, активность СОД можно использовать для отражения способности поглощать свободные радикалы и представлять антиоксидантную способность организма (Нанда и Мадан, 2021). После 12 недель УФ-облучения были изучены изменения активности СОД в четырех группах, которые показаны на рисунках 6А–С. По сравнению с контрольной группой I в других группах наблюдалась потеря активности СОД ( p < 0,05), что свидетельствует о снижении активности по удалению свободных радикалов. Наименьшая активность наблюдалась у мышей в группе Ⅱ, а степень снижения достигала 25%.По сравнению с трижды дистиллированной водой защитный эффект обычного крема и крема G-Rk3 от потери активности СОД составил 32 и 58% соответственно. Следовательно, добавление гинсенозида Rk3 предотвращает потерю активности СОД.

РИСУНОК 6 . Оценка перекисного окисления липидов. Изменения активности СОД (A–C) , активности GSH-Px (D–F) и концентрации МДА (G–I) . Абсолютное значение (A, D, G) . # Достоверно отличается от группы I, p < 0.05. *Не отличается от I группы, р > 0,05. Относительные различия в четырех группах (B, E, H) . Повышение эффективности обычных кремов и кремов G-Rk3 (C, F, I) .

Супероксиды образуются как побочный продукт метаболизма кислорода и, если их не регулировать, могут вызывать многие виды повреждения клеток (Serafini et al., 2015). GSH-Px, пероксидаза, может защищать организм от эндогенно и экзогенно индуцированного перекисного окисления липидов (Pandel et al., 2013). Таким образом, активность GSH-Px отражает антиоксидантную способность организма.Как показано на рисунках 6D–F, резкое снижение активности GSH-Px наблюдалось в группах Ⅱ и Ⅲ после УФ-облучения в течение 12 недель ( p <0,05). Степень снижения в этих группах достигала 26 и 22% соответственно; напротив, в группе IV этот показатель составил всего 5,9%, а значимой разницы с группой I не наблюдалось ( p > 0,05). Таким образом, длительное УФ-облучение оказывало существенное негативное влияние на активность GSH-Px, снижая антиоксидантную способность кожной ткани, но обычный крем почти не предотвращал этот эффект старения.Интересно, что эффект крема G-Rk3 против снижения активности GSH-Px достиг 78%, что в 4,9 раза выше, чем у обычного крема, что свидетельствует о превосходной антиоксидантной способности гинсенозида Rk3.

МДА является одним из продуктов окисления липидов (Dunaway et al., 2018). Таким образом, остаточная концентрация МДА в сыворотке крови может отражать степень перекисного окисления липидов в ткани кожи (Dunaway et al., 2018). На рисунках 6G-I показано, что УФ-облучение увеличило концентрацию МДА на 11% в группе Ⅱ ( p < 0.05). Интересно, что обычный крем также продемонстрировал приемлемое ингибирование окисления липидов в группе Ⅲ ( p > 0,05). При использовании обычных сливок вместо тридистиллированной воды концентрация МДА увеличилась на 4,8%, а эффективность улучшения достигла 57%. Этот эффект можно объяснить тем, что обычный крем мог предотвратить потерю активности СОД (рис. 6) и, таким образом, замедлился рост перекиси водорода, необходимой для окисления липидов. Кроме того, наилучшие результаты наблюдались при использовании крема G-Rk3, поскольку процесс окисления липидов почти останавливался ( p > 0.05). Наблюдалось только увеличение концентрации МДА на 0,8%. Эффективность крема G-Rk3 достигла 92%, что в 1,6 раза выше, чем у обычного крема. Механизм этого эффекта может заключаться в том, что крем G-Rk3 может одновременно эффективно предотвращать потерю активности SOD и GSH-Px. Увеличение содержания пероксида водорода замедлялось, а его удаление восстановлением также ускорялось.

Уровни матриксной металлопротеиназы и оценка коллагена кожи

Предыдущие исследования показали, что ММП могут денатурировать практически все компоненты хряща (Duan et al., 2019; Ли и др., 2021). Таким образом, аномальная экспрессия ММР в ткани кожи ускоряет деградацию внеклеточного матрикса и повреждает соединительные ткани, делая толщину кожи однородной, снижая эластичность кожи и приводя к образованию морщин и другим эффектам фотостарения (Pittayapruek et al., 2016). Наборы ELISA использовали для анализа ММР-1 и ММР-3, как показано на Фигуре 7. Результаты показали, что УФ-облучение стимулировало экспрессию этих ММР. Когда крем G-Rk3 наносили на спину мышей в группе IV, экспрессия MMP-1 ( p > 0.01) и ММП-3 ( p > 0,05) увеличилось всего на 23 и 8,5% соответственно. Эти результаты показали, что эффект обычного крема на ингибирование избыточной экспрессии ММП составлял лишь приблизительно 9% по сравнению с эффектом тройной дистиллированной воды. Однако крем G-Rk3 ингибировал ММР-1 и ММР-3 на 57 и 79% соответственно. Добавление гинзенозида Rk3 к обычному крему повышало его способность ингибировать ММП-1 и ММП-3 в 6,2 и 8,1 раза соответственно.

РИСУНОК 7 .Оценка MMP. Изменения уровней MMP-1 (A–C) и MMP-3 (D–F) . Абсолютное значение (A, D) . ##Очень значимо отличается от группы I, p < 0,01. # Достоверно отличается от группы I, p < 0,05. * Не отличается от группы I, р > 0,05. Относительные различия в четырех группах (B, E) . Повышение эффективности обычных кремов и кремов G-Rk3 (C, F) .

HYP является одним из основных компонентов кожного коллагена и составляет примерно 13.5% коллагена млекопитающих (Shin et al., 2019). Основная функция HYP заключается в обеспечении резкого скручивания спирали коллагена (Shin et al., 2019). Как правило, уровень HYP должен быть стабильным в здоровом состоянии, и его можно использовать для представления уровня коллагена (Shin et al., 2019). Как показано на рисунке 8, содержание HYP в группе модели фотостарения Ⅱ и группе Ⅲ отличалось от такового в контрольной группе I ( p < 0,05). Напротив, статистический анализ показал, что не было никакой разницы между группой IV и группой I ( p > 0.05). По сравнению с мышами, которым вводили тройную дистиллированную воду, содержание HYP у мышей, получавших обычный крем (группа Ⅲ), улучшилось на 31%, а у мышей, получавших крем G-Rk3 (группа IV), увеличилось на 92%. . Таким образом, предотвращение потери HYP улучшилось в 2,9 раза при добавлении в обычный крем гинзенозида Rk3. Приведенные выше результаты продемонстрировали, что G-Rk3 значительно снижает уровни MMP и увеличивает содержание HYP, что является признаком фотостарения коллагена кожи.

РИСУНОК 8 . Оценка коллагена кожи. Абсолютное значение уровней HYP (A) . # Достоверно отличается от группы I, p < 0,05. * Не отличается от группы I, р > 0,05. Относительные различия в четырех группах (B) . Повышение эффективности обычных кремов и кремов G-Rk3 (C) .

Оценка воспаления кожи

Предыдущие исследования показали, что УФ-облучение способствует секреции ИЛ-1, ИЛ-6 и ФНО-α, которые являются тремя важными цитокинами в тканях кожи (Fuller, 2019; Lee et al., 2019). Эти цитокины являются важными триггерами, которые инициируют и регулируют воспаление кожи и составляют важную часть воспалительной реакции организма на инфекцию. Существуя на клеточной поверхности и во внутриклеточных компартментах, эти факторы могут усиливать экспрессию факторов адгезии и активировать трансмиграцию иммунокомпетентных клеток, таких как фагоциты и лимфоциты, в очаги инфекции. Синергический эффект между IL-1, IL-6 и TNF-α обычно вызывает лихорадку, гипералгезию, вазодилатацию и гипотензию.Как показано на фигуре 9, экспериментальные результаты показали, что концентрации IL-1, IL-6 и TNF-α во всех группах отличались от таковых в контрольной группе I ( p <0,05). Концентрации ИЛ-1, ИЛ-6 и ФНО-α в группе II увеличились на 54, 39 и 80% соответственно. Улучшение наблюдалось в группе ложного контроля (группа III), а концентрации ИЛ-1, ИЛ-6 и ФНО-α увеличились на 25, 19 и 63% соответственно. Однако модель фотостарения (группа Ⅱ) и фиктивный контроль (группа Ⅲ) значительно отличались от контроля (группа I) ( p < 0.01). Напротив, в группе IV наблюдалось повышение концентрации ИЛ-1, ИЛ-6 и ФНО-α только на 3,1, 1,2 и 13 % соответственно, что достоверно не отличалось от такового в группе I ( p > 0,01). Эти результаты объясняют, почему у мышей, которым вводили крем G-Rk3 в группе IV, не наблюдалось явного покраснения или аллергии (рис. 2, 4). По сравнению с трижды дистиллированной водой эффективность нормального крема для контроля чрезмерной секреции ИЛ-1 и ИЛ-6 была улучшена примерно на 52%, но у мышей, которым вводили крем G-Rk3 (группа IV). увеличился примерно на 96%.Кроме того, эффект обычного крема в контроле избыточной секреции TNF-α был улучшен только на 21%, а эффект мышей, которым вводили крем G-Rk3 (группа IV), увеличился на 84%. Секреция IL-1 и IL-6, индуцированная УФ-облучением, предотвращалась примерно в 1,8 раза при добавлении гинзенозида Rk3 к обычному крему. Однако при использовании крема G-Rk3 наблюдались значительные улучшения в предотвращении секреции TNF-α. Соответствующий эффект был увеличен на 3.в 9 раз выше, чем у обычного крема.

РИСУНОК 9 . Оценка воспаления кожи. Изменения уровней IL-1 (A–C) , IL-6 (D–F) и TNF-α (G–I) . Абсолютное значение (A, D, G) . ##Очень значимо отличается от группы I, p < 0,01. # Достоверно отличается от группы I, p < 0,05. Относительные различия в четырех группах (B, E, H) . Повышение эффективности обычных кремов и кремов G-Rk3 (C, F, I) .

Заключение

В заключение, гинзенозид Rk3 может повышать эластичность кожи, ингибировать снижение уровня воды и HYP в тканях кожи, а также увеличивать потерю активности SOD и GSH-Px в крови. Более того, гинзенозид Rk3 замедлял или останавливал повышение уровней MDA, MMP-1 и MMP-3 в крови и уровней IL-1, IL-6 и TNF-α в ткани кожи (фиг. 10). Результаты настоящего исследования показывают, что гинзенозид Rk3 обладает сильными свойствами против фотостарения и воспаления для защиты здоровья кожи.

РИСУНОК 10 . Всестороннее сравнение эффектов против фотостарения крема G-Rk3 и обычного крема.

Заявление о доступности данных

Необработанные данные, подтверждающие заключение этой статьи, будут предоставлены авторами без неоправданных оговорок.

Заявление об этике

Исследование на животных было рассмотрено и одобрено Комитетом по управлению экспериментальными животными и этике Северо-Западного университета (NWN-AWC-20210357M).

Вклад авторов

SW и YL внесли свой вклад в разработку концепции и дизайна исследования.JS провел статистический анализ. SW, BL и YL написали первый черновик рукописи. DF перечислил разделы рукописи. Все авторы внесли свой вклад в доработку рукописи, прочитали и одобрили представленную версию.

Финансирование

Это исследование финансировалось Национальным фондом естественных наук Китая (22078264, 22108224 и 21808184), Ключевой программой исследований и изобретений в провинции Шэньси, Китай (2020NY-127), Научно-исследовательскими проектами департамента провинции Шэньси. образования (21JK0940) и План поддержки молодых талантов Сианьской ассоциации науки и техники (095

1301).

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечание издателя

Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов. Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Ссылки

Брем Р., Гювен М. и Карран П. (2017). Окислительное повреждение ДНК и белков, опосредованное фотосенсибилизированным УФА. Свободный радикал. биол. Мед. 107, 101–109. doi:10.1016/j.freeradbiomed.2016.10.488

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Чен С., Хэ З. и Сюй Дж. (2020). Применение стволовых клеток, полученных из жировой ткани, при фотостарении: обзор фундаментальной науки и литературы. Ствол Cel Res Ther 11, 491.doi:10.1186/s13287-020-01994-z

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Duan, X., Wu, T., Liu, T., Yang, H., Ding, X., Chen, Y., et al. (2019). Виценин-2 уменьшает окислительное повреждение и фотостарение посредством модуляции сигналов MAPK и MMP в клетках кожи человека, подвергшихся воздействию УФ-В излучения. J. Photochem. Фотобиол. Б 190, 76–85. doi:10.1016/j.jphotobiol.2018.11.018

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Данауэй, С., Один Р., Чжоу Л., Цзи Л., Чжан Ю. и Кадекаро А. Л. (2018). Природные антиоксиданты: несколько механизмов защиты кожи от солнечного излучения. Фронт. Фармакол. 9, 392. doi:10.3389/fphar.2018.00392

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Фуллер, Б. (2019). Роль PGE-2 и других медиаторов воспаления в старении кожи и их ингибирование местными природными противовоспалительными средствами. Косметика 6, 6. doi:10.3390/cosmetics6010006

CrossRef Полный текст | Google Scholar

Гао Ю., Лю В., Чжоу Б., Ли В. и Луо Д. (2010). Ginsenoside-Rg1 защищает фибробласты кожи человека от фотостарения, вызванного 8-метоксипсораленом и ультрафиолетом А, посредством P53-зависимых сигнальных путей. Zhongguo Yaolixue Tongbao 26, 383–387.

Google Scholar

Громковска Кемпка К. Дж., Пушцион-Якубик А., Маркевич-Жуковска Р. и Соча К. (2021). Влияние ультрафиолетового излучения на фотостарение кожи – обзор исследований In Vitro . Дж.Космет. Дерматол. doi:10.1111/jocd.14033

Полный текст CrossRef | Google Scholar

Хан Дж., Ли Э., Ким Э., Йом М. Х., Квон О., Юн Т. Х. и др. (2014). Роль эпидермального γδ Т-клеточного интерлейкина 13 в эффекте отбеливания кожи гинзенозида F1. Экспл. Дерматол. 23, 860–862. doi:10.1111/exd.12531

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Хуанг А. Х. и Чиен А. Л. (2020). Фотостарение: обзор современной литературы. Курс. Дерм. респ. 9, 22–29. doi:10.1007/s13671-020-00288-0

CrossRef Full Text | Google Scholar

Кандан П.В., Балупиллаи А., Каниможи Г., Хан Х.А., Алхомида А.С. и Прасад Н.Р. (2020). Опунтиол предотвращает фотостарение кожи мышей, блокируя воспалительные реакции и деградацию коллагена. Оксид Мед. Cel Longev 2020, 5275178. doi:10.1155/2020/5275178

CrossRef Полный текст | Google Scholar

Ke, Y. и Wang, X.-J.(2021). Передача сигналов TGFβ при фотостарении и раке кожи, индуцированном УФ-излучением. Дж. Инвест. Дерматол. 141, 1104–1110. doi:10.1016/j.jid.2020.11.007

Полный текст CrossRef | Google Scholar

Лай-Чеонг, Дж. Э., и Макграт, Дж. А. (2017). Строение и функции кожи, волос и ногтей. Медицина 45, 347–351. doi:10.1016/j.mpmed.2017.03.004

Полный текст CrossRef | Google Scholar

Ли Э. Х., Пак Х. Дж., Ким Х. Х., Юнг Х. Ю., Канг И. К. и Чо Ю.Дж. (2021). Изокверцитрин, выделенный из кожуры зеленого шара яблока, ингибирует фотостарение в клетках фибробластов CCD-986Sk посредством модуляции передачи сигналов MMP. Дж. Космет. Дерматол. 20, 2932–2939. doi:10.1111/jocd.13903

Полный текст CrossRef | Google Scholar

Ли, К. Дж., Парк, К. Х., и Хан, Дж. Х. (2019). Облегчение фотостарения, вызванного ультрафиолетовым излучением В, с помощью пептида-антагониста TNFR, TNFR2-SKE. Мол. Ячейка 42, 151–160. doi:10.14348/molcells.2018.0423

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Лю, X.Ю., Хван Э., Пак Б., Нго, Х.Т.Т., Сяо, Ю.К., и Йи, Т.Х. (2018). Гинзенозид C-Mx, выделенный из гинзенозидов стебля и листа нотоженьшеня, ослабляет фотостарение, опосредованное ультрафиолетовым излучением В, в фибробластах кожи человека. Фотохим. Фотобиол. 94, 1040–1048. doi:10.1111/php.12940

Резюме PubMed | Полный текст перекрестной ссылки | Google Scholar

Лю Ю. и Фан Д. (2019). Гинзенозид Rg5 индуцирует остановку фазы G2/M, апоптоз и аутофагию посредством регуляции ROS-опосредованных путей MAPK против рака желудка человека. Биохим. Фармакол. 168, 285–304. doi:10.1016/j.bcp.2019.07.008

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Лайонс, А. Б., Труллас, К., Кохли, И., Хамзави, И. Х., и Лим, Х. В. (2021). Фотозащита за пределами ультрафиолетового излучения: обзор тонированных солнцезащитных средств. Дж. Ам. акад. Дерматол. 84, 1393–1397. doi:10.1016/j.jaad.2020.04.079

Полный текст CrossRef | Google Scholar

Нам, Дж. Дж., Мин, Дж. Э., Сон, М. Х., О, Дж. Х.и Канг С. (2017). Индуцированная ультрафиолетовым и инфракрасным излучением 11-бета-гидроксистероиддегидрогеназа типа 1, активирующая фотостарение кожи, ингибируется экстрактом красного женьшеня, содержащим высокую концентрацию гинзенозида Rg3(S). Фотодерматол. Фотоиммунол Фотомед. 33, 311–320. doi:10.1111/phpp.12337

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Нанда, С., и Мадан, К. (2021). Роль экстрактов сафрана и стигмы шафрана в окислительном стрессе, заболеваниях и фотостарении: систематический обзор. Гелион 7, e06117. doi:10.1016/j.heliyon.2021.e06117

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Пандель Р., Полишак Б., Годич А. и Дахмане Р. (2013). Фотостарение кожи и роль антиоксидантов в его предотвращении. МСРН Дерматол. 2013, 930164–930211. doi:10.1155/2013/930164

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Петрук Г., Дель Джудиче Р., Ригано М. М. и Монти Д. М. (2018). Антиоксиданты из растений защищают от фотостарения кожи. Окислительная Мед. Cell Longevity 2018, 1–11. doi:10.1155/2018/1454936

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Питтаяпруек П., Мифансан Дж., Прапапан О., Комине М. и Оцуки М. (2016). Роль матриксных металлопротеиназ в фотостарении и фотоканцерогенезе. Междунар. Дж. Мол. науч. 17, 868. doi:10.3390/ijms17060868

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Цюй Л., Чжу Ю., Лю Ю., Ян Х., Чжу С., Ма, П. и др. (2019). Защитные эффекты гинзенозида Rk3 против хронического повреждения печени, вызванного алкоголем, у мышей посредством ингибирования воспаления, окислительного стресса и апоптоза. Пищевая хим. Токсикол. 126, 277–284. doi:10.1016/j.fct.2019.02.032

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Самбандан, Д. Р., и Ратнер, Д. (2011). Солнцезащитные кремы: обзор и обновление. Дж. Ам. акад. Дерматол. 64, 748–758. doi:10.1016/j.jaad.2010.01.005

Полный текст CrossRef | Google Scholar

Сандер, М., Сандер М., Бербидж Т. и Бикер Дж. (2021). Эффективность и безопасность солнцезащитных кремов для профилактики рака кожи. Кан. Мед. доц. J. 193, 348–354. doi:10.1503/cmaj.201085-f

Полный текст CrossRef | Google Scholar

Серафини, М. Р., Гимарайнш, А. Г., Квинтанс, Дж. С., Араужо, А. А., Нуньес, П. С., и Квинтанс-Джуниор, Л. Дж. (2015). Природные соединения для солнечной фотозащиты: обзор патентов. Экспертное заключение. тер. Пат 25, 467–478. дои: 10.1517/13543776.2014.1000863

Реферат PubMed | Полный текст перекрестной ссылки | Google Scholar

Шин, Дж.-В., Квон, С.-Х., Чой, Дж.-Ю., На, Дж.-И., Ха, Ч.-Х., Чой, Х.-Р. ., и другие. (2019). Молекулярные механизмы старения кожи и подходы к борьбе со старением. Ijms 20, 2126. doi:10.3390/ijms200

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Вонг, А.С., Че, К.М., и Леунг, К.В. (2015). Последние достижения в области применения женьшеня в качестве средства для лечения рака: функциональный и механистический обзор. Нац. Произв. 32, 256–272. doi:10.1039/c4np00080c

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Xiao, Z., Yang, S., Chen, J., Li, C., Zhou, C., Hong, P., et al. (2020). Трегалоза против фотостарения кожи, вызванного УФ-В, путем подавления экспрессии MMP и усиления синтеза проколлагена I в клетках HaCaT. J. Функц. Foods 74, 104198. doi:10.1016/j.jff.2020.104198

CrossRef Полный текст | Google Scholar

Сюй, X. Х., Ли, Т., Fong, C.M., Chen, X., Chen, X.J., Wang, Y.T., et al. (2016). Сапонины из китайских лекарств как противораковые агенты. Molecules 21, 1326. doi:10.3390/molecules21101326

PubMed Abstract | Полный текст перекрестной ссылки | Google Scholar

Влияние УФ-фотографий, информация о фотостарении и использование лосьона для загара на солнцезащитном поведении | Дерматология | JAMA Дерматология

Цели Изучить эффективность УФ-фотографий и информации о фотостарении (например, о морщинах и пигментных пятнах) для улучшения намерений и поведения молодых людей в отношении защиты от солнца, а также определить, можно ли усилить какие-либо эффекты этого вмешательства, основанного на внешнем виде, путем предоставления УФ-альтернатива для получения загара (например, лосьон для загара).

Дизайн Рандомизированное контрольное исследование с последующим наблюдением в течение 1 месяца.

Настройка Два университета в Южной Калифорнии.

Участники Добровольная выборка из 146 студентов колледжа, 91,1% из которых завершили «неожиданное» 1-месячное последующее наблюдение.

Вмешательство УФ-фотография лица и короткая видеозапись, описывающая причины и последствия фотостарения. В исследовании проверялись эффекты только информации о фотостарении / УФ-фотографии, вмешательства плюс использование лосьона для загара без солнца и контрольного состояния.

Показатели основных результатов Намерения участников защищаться от солнца, оцененные сразу после вмешательства, и поведение защиты от солнца в течение месяца после вмешательства, оцененное во время неожиданного телефонного разговора.

Результаты Вмешательство привело к значительно более сильным намерениям защищаться от солнца ( P <0,001) и лучшему поведению в отношении защиты от солнца ( P <0,05) по сравнению с контрольной группой. Кроме того, группа, которая также использовала солнцезащитный лосьон для загара, была склонна к большей защите от солнца, чем группа, которая подвергалась вмешательству только ( P <.08).

Заключение Вмешательство с помощью УФ-фотографии обещает стать экономически эффективным подходом к мотивации практики, которая в конечном итоге может принести пользу для здоровья (т. е. снизить уровень заболеваемости раком кожи).

Заболеваемость новыми случаями рака кожи увеличивается со скоростью от 3% до 4% в год, 1 и заболеваемость самой смертельной формой рака кожи (меланомой) растет быстрее, чем любой другой тип рака рак. 2 Широко известно, что большинство случаев рака кожи можно предотвратить. 1 Меры профилактики включают ограничение пребывания на солнце в полуденные часы (с 10:00 до 15:00 [ранее с 10:00 до 14:00]), ношение защитной одежды и использование солнцезащитного крема с солнцезащитным фактором (SPF) не менее 15. 1 В течение последних нескольких десятилетий исследователи из различных дисциплин стремились понять механизмы, лежащие в основе поведения на солнце и защиты от солнца. Несмотря на то, что программы общественного образования и внимание средств массовой информации способствовали повышению осведомленности о рисках для здоровья (рак кожи) воздействия УФ-излучения, 3 медико-санитарные образовательные мероприятия оказались значительно менее успешными в мотивации изменения поведения. 4 -11 В частности, молодые люди, мотивированные предполагаемыми преимуществами загорелой кожи, улучшающими внешний вид, продолжают подвергаться преднамеренному и непреднамеренному воздействию УФ-излучения в больших количествах. 3 ,8 ,12 -14 В этой популяции возможность развития рака кожи в отдаленном будущем может иметь не такое большое значение при принятии поведенческих решений, как уверенность в немедленном улучшении внешности.

Вмешательства, направленные на устранение беспокойства людей по поводу внешнего вида, могут быть более эффективными, чем одни только предупреждения о вреде для здоровья, для противодействия сильному нормативному влиянию на загар. 8 ,15 -22 Небольшой, но растущий объем работ показывает, что эффективной стратегией может быть подчеркивание того, что воздействие УФ-излучения может иметь негативные последствия для внешности (например, морщины и пигментные пятна). 19 -21,23 Например, Mahler et al. 15 сделали негативные последствия воздействия УФ-излучения более заметными, определенными и непосредственными для людей, показав им фотографию их собственного лица, сделанную с помощью УФ-фильтра, на котором изображена неравномерная эпидермальная пигментация, вызванная хроническим воздействием УФ-излучения.И студенты колледжей, и посетители пляжей, которые просматривали свои фотографии в ультрафиолетовом диапазоне, выразили большее намерение защищаться от солнца, чем контрольная группа. Кроме того, в течение 1 месяца наблюдения, проведенного с посетителями пляжа, те, кто просматривал их УФ-фотографии, сообщили о том, что они более активно защищались от солнца, чем контрольная группа. Хотя эти первоначальные результаты являются многообещающими, мы должны быть в состоянии воспроизвести их. Кроме того, посетители пляжа в Mahler et al 15 знали, что будет проводиться последующее наблюдение, и поэтому они могли изменить свое поведение в ожидании последующего наблюдения.

Одной из целей настоящего исследования было определить, можно ли воспроизвести результаты Mahler et al 15 , когда участники не знали, что с ними свяжутся для последующего наблюдения. Кроме того, мы стремились определить, можно ли усилить воздействие УФ-фотографии, предложив людям альтернативный метод получения загара: лосьон для загара без солнца. Предполагалось, что лосьон для загара без солнца является эффективной альтернативой УФ-облучению с низким уровнем риска, которая может дать те же преимущества для внешнего вида, что и фактическое УФ-облучение.Таким образом, исходя из Теории альтернативного поведения, 24 ,25 повышение восприятия людьми рисков воздействия УФ-излучения при одновременном предоставлении им жизнеспособной альтернативы для получения загара должно быть особенно эффективным в изменении поведения, связанного с защитой от солнца.

Мы ожидали, что получение информации о фотостарении и просмотр УФ-фотографий лица приведут к усилению намерений и поведения в отношении защиты от солнца. Мы также предположили, что вмешательство повлияет на некоторые представления о фотостарении и защите от солнца.В частности, мы ожидали, что вмешательство приведет к снижению предполагаемых затрат на защиту от солнца и вознаграждению за пребывание на солнце, а также к большей воспринимаемой восприимчивости к фотостарению, тяжести фотостарения, эффективности защиты от солнца для предотвращения фотостарения и самоэффективности при регулярном использовании солнцезащитного крема. . Наконец, мы выдвинули гипотезу о том, что люди, которые подверглись вмешательству плюс образец солярия без солнца, будут демонстрировать самые большие намерения и поведение в отношении защиты от солнца.

Исследуемая популяция и процедуры

Исследуемая группа состояла из 54 студентов Калифорнийского университета в Сан-Диего (41 женщина и 13 мужчин) и 92 студентов Калифорнийского государственного университета в Сан-Маркосе (73 женщины и 19 мужчин).Участники записались на исследование, названное просто «Отношение к здоровью», что частично соответствует требованиям вводных курсов психологии в обоих учреждениях.

Участники запускались индивидуально или парами (разделенные перегородкой). Условия, которые должны выполняться во время каждого сеанса, определялись в начале периода сбора данных с использованием процедуры блочной рандомизации. После предоставления письменного информированного согласия все участники заполнили первую анкету, в которой оценивались демографические данные и исходное поведение при принятии солнечных ванн и защите от солнца.После этого люди из контрольной группы приступили непосредственно ко второму опроснику, предназначенному для оценки будущих намерений использовать солнцезащитный крем и нескольких показателей их восприятия фотостарения и защиты от солнца.

Перед заполнением второго вопросника участники групп вмешательства просматривали видео о фотостарении, им показывали свои УФ-фотографии. Сразу после вмешательства и до того, как они заполнили второй вопросник, участники группы вмешательства плюс солярий без солнца получили бутылку объемом 6 унций (177 мл) либо Neutrogena (Лос-Анджелес, Калифорния), либо SkinMedica (Энсинитас, Калифорния) для загара без солнца. лосьон, содержащий дигидроксиацетон.Экспериментатор объяснил этим участникам, как использовать лосьон для загара без солнца, заявил, что использование лосьона для загара без солнца — единственный безопасный способ получить загар, и сообщил участникам, что лосьон для загара без солнца не обеспечивает защиту от солнца.

В конце сеанса всем участникам был предоставлен образец солнцезащитного крема якобы в качестве благодарственного подарка за участие в исследовании. Процедуры исследования были одобрены институциональным наблюдательным советом в каждом учреждении.

Информационное вмешательство в области УФ-фотографии и фотостарения

Вмешательство состояло из 12-минутного видео и фотографии лица в УФ-излучении, сделанной камерой мгновенного действия. В видео определялось фотостарение (преждевременные морщины и пигментные пятна из-за УФ-излучения) и обсуждались способы уменьшения воздействия УФ-излучения (использование солнцезащитного крема с SPF не менее 15 и избегание пребывания на солнце с 10:00 до 14:00). .Видео также предоставило общую информацию о солнцезащитном креме, например, объяснило, что означает SPF и сколько солнцезащитного крема нужно использовать.

УФ-фотографии лица были сделаны с помощью однообъективной зеркальной камеры, оснащенной профессиональной черно-белой моментальной пленкой Polaroid 667 (Waltham, Mass) и УФ-фильтром. Этот отфильтрованный ультрафиолетовый свет поглощается меланином кожи. Полученная черно-белая фотография четко и резко подчеркивает неравномерную пигментацию эпидермиса, возникшую в результате хронического пребывания на солнце. 26 ,27 Каждому человеку, у которого была сделана УФ-фотография, также была сделана мгновенная фотография при естественном освещении для сравнения. Во всех случаях участникам сначала показывали черно-белую фотографию при естественном освещении, а затем УФ-фотографию. Участникам сказали, что любые «темные участки, веснушки или ямки» на УФ-фотографии (которых не было на снимке при естественном освещении) указывают на существующее основное повреждение кожи, которое будет продолжать ухудшаться, если они не будут более активно защищаться от солнца. (чем сейчас).

Базовая оценка воздействия УФ-излучения и защиты включала самоотчеты о (1) количестве часов, проведенных на солнце в течение предыдущих выходных; (2) количество часов, проведенных на солнце за другой деятельностью, кроме принятия солнечных ванн, в течение предыдущей недели и выходных соответственно; (3) частота использования солнцезащитного крема на лице и теле (по шкале от 0% до 100%) во время принятия солнечных ванн и, отдельно, во время других занятий на солнце; и (4) уровень SPF солнцезащитного крема, наносимого на лицо и тело во время принятия солнечных ванн и, отдельно, при других мероприятиях на свежем воздухе.

Девять пунктов, оцениваемых по отдельным 5-балльным шкалам (1, категорически не согласен – 5, полностью согласен), оценивали намерения использовать солнцезащитный крем в будущем (например, «Я планирую чаще наносить солнцезащитный крем на лицо, когда загораю» или «Я планирую ежедневно наносить солнцезащитный крем на все открытые участки тела»). Как и в предыдущей работе, 15 ,20 эти 9 элементов показали высокую внутреннюю согласованность (Кронбах α = 0,92), и поэтому они были усреднены в индексе намерений для анализа.

Было разработано несколько коротких шкал для оценки восприятия участниками фотостарения и защиты от солнца. Большинство конкретных пунктов для этих весов были получены из предыдущих исследований по защите от солнца, 6 ,18 , и все они были успешно использованы в предыдущей работе нашей командой. 15 ,20 Участники указали уровень своего согласия с каждым пунктом по отдельной 5-балльной шкале (1, категорически не согласен – 5, полностью согласен). Воспринимаемое вознаграждение за солнечные ванны и загар оценивалось по 10 пунктам (α = .89; например: «Я думаю, что выгляжу здоровее, когда у меня есть загар»). В двенадцати пунктах оценивалась стоимость использования солнцезащитного крема (α = 0,76; например, «Летом слишком хорошо, чтобы не выходить на улицу с 10:00 до 14:00»). Воспринимаемая предрасположенность к фотостарению оценивалась по 8 пунктам (α = 0,77; например, «Я не провожу достаточно времени на солнце, чтобы беспокоиться о появлении морщин и пигментных пятен»). Четыре пункта оценивали восприятие серьезности фотостарения (α = 0,79; например, «Было бы ужасно иметь морщины на моем лице»). Воспринимаемая эффективность использования солнцезащитного крема для предотвращения фотостарения оценивалась по 4 пунктам (α = .65; например, «Появляются ли у людей морщины и возрастные пятна, напрямую связано с тем, как часто они используют солнцезащитный крем, проводя время на солнце»). Наконец, чтобы оценить самоэффективность регулярного использования солнцезащитного крема, участники указали по 12 отдельным 10-балльным шкалам (от 1, я уверен, что не могу до 10, я уверен, что смогу), насколько они уверены, что могут мотивировать себя использовать солнцезащитный крем, несмотря на препятствия (α = 0,92; например, «Используйте солнцезащитный крем, даже если мне лень возиться с ним»). Эта мера самоэффективности была тесно связана с аналогичными мерами, успешно используемыми исследователями в других областях. 28 ,29

Последующие телефонные процедуры и меры

Примерно через 1 месяц после вмешательства (среднее [SD] последующего наблюдения, 27,36 [7,42] дня) с участниками неожиданно связались по телефону (91,1% были охвачены) и задали несколько вопросов, касающихся их поведения на солнце и защиты от солнца с момента их первоначального участие в исследовании (рисунок).Участники предоставили устное информированное согласие во время телефонного контакта (в соответствии с политикой институционального наблюдательного совета в обоих учреждениях). Интервьюеры, проводившие последующее наблюдение, не знали о групповом назначении каждого участника.

Для оценки преднамеренного пребывания на солнце участников попросили оценить количество часов, которые они загорали с момента своего участия. Участников также попросили оценить среднее количество часов, которые они провели на солнце, занимаясь другими видами деятельности в обычный будний и выходные дни соответственно.Затем эти оценки были усреднены, чтобы сформировать индекс 90 525 случайного воздействия солнца 90 526 (90 525 r 90 526 [130] = 0,58; 90 525 P 90 526 <0,001). Кроме того, участников спросили, пользовались ли они солнцезащитным кремом в последний раз, когда они загорали (да, нет), и как часто они наносили солнцезащитный крем на лицо и тело во время принятия солнечных ванн (0–100 %), начиная с их участие. Участникам также задавали те же самые 3 вопроса относительно случайного пребывания на солнце.

Отдельные 3-элементные индексы защиты от загара (α = 0,77) и защиты от случайного солнца (α = 0,75) впоследствии были созданы путем сначала стандартизации (посредством оценки z ), ​​а затем усреднения соответствующих позиций. Затем участников спросили (да, нет), пользовались ли они бесплатным образцом солнцезащитного крема, отдавали ли они образец и покупали ли они какой-либо солнцезащитный крем после участия в эксперименте. Ответы на эти 3 вопроса были усреднены для создания индекса использования 90 525 образцов и покупки солнцезащитного крема 90 526.Тех, кому дали образец автозагара для загара, также спросили, сколько раз они использовали этот образец. Наконец, участников спросили, со сколькими членами семьи или друзьями (если таковые имеются) они обсудили информацию, полученную в результате их участия. Затем они были полностью опрошены.

Чтобы определить исходную эквивалентность групп, был использован однофакторный дисперсионный анализ для сравнения экспериментальной и контрольной групп по демографическим характеристикам и исходным переменным воздействия солнца и защиты от солнца.Любая демографическая или исходная переменная, отличающаяся между группами и имеющая значительную связь с показателями результатов, контролировалась в последующих анализах.

Будущие намерения использовать солнцезащитный крем и все последующие 1-месячные меры были проанализированы с использованием набора запланированных ортогональных сравнений 30 , которые включали сравнение 2 групп вмешательства с контрольной группой и отдельное сравнение группы только вмешательства с вмешательством плюс группа солнцезащитных средств для загара.Мы контролировали соответствующие уровни исходного воздействия солнца или защиты от солнца при анализе последующего воздействия солнца в течение 1 месяца и мер защиты от солнца.

Чтобы свести к минимуму количество тестов и экспериментальную ошибку, множественные показатели восприятия фотостарения и защиты от солнца были сначала проанализированы с использованием многомерного ковариационного анализа с последующим отдельным запланированным сравнением для каждого показателя.

Описание выборки и исходной эквивалентности групп

Участники были в основном белыми, и их среднее значение (SD) составляло 22.21 (4,66) года (возрастной диапазон 17-44 года). Двадцать процентов участников сообщили, что загорали не менее 1 часа в предыдущие выходные; 93,8% сообщили, что в предыдущие выходные провели на солнце не менее 1 часа, занимаясь чем-то другим, кроме принятия солнечных ванн; и 96,6% провели не менее 1 часа на солнце, занимаясь чем-то кроме принятия солнечных ванн в течение предыдущей недели. Пятьдесят шесть процентов участников сообщили, что знают по крайней мере 1 человека с раком кожи, а 41,8% сообщили, что у них есть по крайней мере 1 член семьи с раком кожи.В таблице 1 перечислены дополнительные демографические и базовые характеристики защиты от солнца для выборки. Данные от 3 человек (по 1 в каждой группе) были исключены (1 из-за того, что человеку случайно дали второй образец солнцезащитного крема, а не образец средства для загара без солнца; 1 из-за состояния здоровья, требующего ежедневного использования солнцезащитного крема; солнечные ванны были более чем на 35 SD выше среднего).

Результаты не выявили существенных различий или тенденций между 3 группами по возрасту, этнической принадлежности, уровню образования, типу кожи, 31 , был ли у участников когда-либо рак кожи, или количеству близких членов семьи, у которых когда-либо был рак кожи.Точно так же не было групповых различий в исходных показателях времени, затрачиваемого на солнечные ванны в выходные дни до участия; время случайного пребывания на солнце за неделю или выходные до участия; частота использования солнцезащитного крема на лице во время принятия солнечных ванн; или частота использования солнцезащитного крема на лице или теле во время случайного пребывания на солнце.

Участники группы только вмешательства сообщили о более низкой ( P  = 0,05) средней частоте использования солнцезащитного крема на теле во время принятия солнечных ванн (37.1%), чем в группе вмешательства плюс солярий (61,0%) или в контрольной группе (52,4%). Таким образом, для статистического контроля возможного искажающего влияния этой исходной переменной она была включена как ковариата в анализ любой меры исхода, с которой она коррелировала при P <0,10.

Та же картина результатов, представленных для общей выборки, была получена, когда анализ проводился для участников из каждого кампуса отдельно, только для белых участников и только для лиц с высоким уровнем случайного воздействия (те, кто набрал выше медианы в часах случайного воздействия на исходном уровне). ).

Намерения использовать солнцезащитный крем

В соответствии с нашими ожиданиями анализ шкалы намерений показал, что участники обеих групп вмешательства выразили значительно более сильные намерения регулярно использовать солнцезащитный крем в будущем, чем участники контрольной группы ( P <0,001). Как показано в Таблице 2, среднее значение по шкале, используемой для измерения намерения использовать солнцезащитный крем, было выше для участников группы вмешательства плюс средства для загара без солнца, чем для участников группы только вмешательства, хотя эта разница не была значимой ( P  = .37).

Восприятие фотостарения и защиты от солнца

Многофакторный анализ результатов ковариации показал, что вмешательство также изменило общее восприятие участниками фотостарения и защиты от солнца ( P <0,02). Однофакторные сравнения показали, что по сравнению с контрольной группой участники групп вмешательства сообщили о значительно более высокой самоэффективности при регулярном использовании солнцезащитного крема ( P <.05), более высокая воспринимаемая восприимчивость к фотостарению ( P <0,002) и более высокая предполагаемая эффективность солнцезащитного крема для предотвращения фотостарения ( P <0,004). Кроме того, участники группы «Вмешательство плюс солярий без солнца» продемонстрировали незначительно более высокую самоэффективность при использовании солнцезащитного крема ( P <0,08) и значительно более высокую воспринимаемую восприимчивость к фотостарению ( P <0,01), чем участники только вмешательства. группа.

Последующие меры по телефону в течение 1 месяца

Только 37% лиц, которым был предоставлен образец автозагара, сообщили об его использовании.Наша цель состояла в том, чтобы определить, повысит ли альтернативный метод получения загара поведение людей, защищающих от солнца. Поскольку у тех, кто не пробовал образец, не было возможности испытать лосьон для загара без солнца в качестве жизнеспособного альтернативного метода, анализ, представленный ниже, включал только тех людей в группе вмешательства плюс соляриев без солнца, которые сообщили об использовании образца по крайней мере один раз и не включают 8,9% участников, с которыми не удалось связаться для последующего наблюдения. Тем не менее, та же картина результатов была получена, когда в анализ были включены лица из группы вмешательства и тех, кто не загорал на солнце, но не использовали солярий.

Как указано в таблицах 1 и 2, и в соответствии с предыдущими исследованиями нашей группы 15 и ранее опубликованными нормами населения для жителей Сан-Диего, 32 , участники настоящего исследования сообщали о очень немногих часах преднамеренного пребывания на солнце как до, так и после вмешательство. Ни вмешательство само по себе, ни вмешательство в сочетании с использованием средств для загара без загара существенно не снизили эти и без того низкие показатели загара, хотя среднее зарегистрированное количество часов, проведенных на солнечных ваннах, было самым низким для участников группы вмешательства и солярия без солнца (таблица 2).

Для тех лиц, которые сообщили о том, что принимали солнечные ванны не менее 15 минут во время последующего наблюдения (n = 20), анализ индекса поведения, направленного на защиту от солнца, во время принятия солнечных ванн показал, что участники группы, проводившей вмешательство в сочетании с теми, кто загорал на солнце, сообщали о самом высоком уровне защиты от солнца во время принятия солнечных ванн ( Таблица 2). Однако, вероятно, из-за небольшого размера выборки эффекты не достигли статистической значимости ( P >0,11 во всех анализах).

Вмешательство также не повлияло на количество случаев случайного пребывания на солнце, о которых сообщали отдельные лица в течение последующего месяца.Тем не менее, вмешательство значительно увеличило использование солнцезащитных средств во время случайного пребывания на солнце. В частности, анализ последующего индекса защитного поведения во время случайного воздействия показал, что субъекты в группах вмешательства были более склонны к использованию защиты, чем в контрольной группе ( P <0,02). Кроме того, использование автозагара для загара имело тенденцию к дальнейшему повышению уровня защитного поведения в течение периода наблюдения по сравнению с вмешательством в одиночку ( P <.08; Таблица 2).

Анализ индекса использования солнцезащитного крема показал, что участники обеих экспериментальных групп с большей вероятностью, чем контрольная группа, использовали бесплатный образец солнцезащитного крема и покупали дополнительный солнцезащитный крем ( P <0,09). Опять же, у тех, кто принимал участие в эксперименте и в группе, получавшей загар без солнца, были самые высокие средние баллы (таблица 2), но эти баллы существенно не отличались от показателей в группе, принимавшей только вмешательство ( P  = 0,30).

Наконец, 61% участников указали, что они рассказали по крайней мере 1 другу или члену семьи о том, что они узнали из исследования об УФ-повреждениях и защите от солнца.Как и ожидалось, анализ показал, что участники в группах вмешательства (которые получили информацию о фотостарении и просматривали свои УФ-фотографии) говорили со значительно большим количеством друзей и родственников о том, что они узнали, чем участники контрольной группы ( P <0,001; Таблица 2). Различий между двумя группами вмешательства не было.

Учитывая рост заболеваемости раком кожи, важно разработать эффективные меры по снижению риска.Хотя медицинские вмешательства имели ограниченный успех в снижении рискованного поведения, такие вмешательства, как правило, игнорируют один из основных мотивов поведения, связанного с риском рака кожи, — немедленное улучшение внешнего вида. Настоящие результаты дополняют данные, свидетельствующие о том, что вмешательства, основанные на внешнем виде, обещают мотивацию действий, которые в конечном итоге принесут пользу для здоровья (т. е. снижение заболеваемости раком кожи). Несмотря на то, что вмешательство не оказало существенного влияния на преднамеренное или случайное пребывание на солнце, были отмечены значительные изменения в поведении в отношении защиты от солнца (например, использование солнцезащитного крема).В частности, люди, которые получили информацию о фотостарении и которым были показаны их УФ-фотографии лица, выработали более сильные намерения, чем контрольная группа, чтобы защитить себя от солнца, с большей вероятностью сообщали об использовании солнцезащитных средств во время последующего случайного пребывания на солнце и с большей вероятностью использовали предоставленные средства защиты от солнца. образец солнцезащитного крема и/или приобрести солнцезащитный крем.

Эти результаты согласуются с единственным ранее опубликованным эмпирическим исследованием УФ-фотографического вмешательства. 15 Однако, в отличие от этого исследования, присутствовавшие участники понятия не имели, что с ними свяжутся для последующего наблюдения, что делало неправдоподобным представление о том, что ожидание сообщения о солнцезащитном поведении, а не вмешательство, было причиной увеличения поведение при защите от солнца.

В соответствии с выводами Mahler et al, 15 участников, которым показали их УФ-фотографии, поделились полученной информацией о воздействии УФ-излучения и защите от солнца с большим количеством членов семьи и друзей, чем в контрольной группе.Важно отметить, что участники просматривали свои УФ-фотографии всего несколько минут, и им не разрешалось брать фотографии с собой. Вполне возможно, что если бы фотографии были предоставлены отдельным лицам, то воздействие усилилось бы. То есть время от времени просмотр такой фотографии может напомнить людям о накопленном вреде от солнца и помочь поддерживать более высокий уровень мотивации для защиты от солнца. Кроме того, фотография может стать центром дискуссий о защите от солнца с друзьями и семьей и, таким образом, иметь более далеко идущие положительные эффекты.

Мы также обнаружили, что некоторые представления о фотостарении и защите от солнца изменились в результате получения информации о фотостарении и просмотра УФ-фотографии. В частности, те, кто получил вмешательство, по сравнению с контрольной группой, стали считать себя более восприимчивыми к фотостарению, стали более убежденными в эффективности солнцезащитного крема как метода предотвращения фотостарения и стали более уверенными в своей способности регулярно использовать солнцезащитный крем. Вывод о том, что такое восприятие было изменено вмешательством, важен, учитывая, что большинство моделей поведения в отношении здоровья (например, модель убеждений в отношении здоровья, 33 именно такое восприятие необходимо для изменения поведения, связанного с риском для здоровья.Таким образом, вполне возможно, что воздействие УФ-фотографии на намерения и поведение в отношении защиты от солнца было опосредовано этим восприятием. Однако также стоит отметить, что в соответствии с существующей литературой по рискам для здоровья влияние вмешательства на намерения и восприятие риска было более последовательным, чем влияние на поведение. Изменение намерений и восприятия риска необходимо, но не всегда достаточно для изменения поведения.

К сожалению, эффект от предоставления людям лосьона для загара без солнца в качестве безопасной альтернативы воздействию УФ-излучения не был существенным.Хотя средние значения показали улучшение по всем 7 исходам, для которых ожидалась разница, группа, получавшая вмешательство плюс лосьон для загара без солнца, отличалась от группы, получавшей только вмешательство, только по одному из этих исходов, и то незначительно (большее использование солнцезащитных средств во время лечения). случайное воздействие). Наиболее вероятным объяснением этих слабых эффектов является более низкая статистическая мощность небольшой группы загара в темноте: в нее вошли только участники, которые действительно использовали выборку. В ходе наших телефонных опросов мы обнаружили, что многие люди отрицательно относятся к лосьонам для загара без солнца.Например, несколько человек отметили, что они никогда не будут использовать лосьон для загара без солнца, потому что, среди прочего, они слышали, что он не выглядит естественным, он окрашивает их кожу в оранжевый цвет и оставляет «полосатый» вид. Поскольку только 37% участников пробовали образец лосьона для загара без солнца, у большинства не было возможности выработать положительное отношение к нему как к альтернативному методу получения загара. Возможно, потребуется развенчать мифы о лосьоне для загара без солнца или разработать методы побуждения участников попробовать его, чтобы способствовать формированию положительного отношения к этой альтернативе.

Этот эксперимент имеет несколько методологических преимуществ. Новый метод снижения риска развития рака кожи был оценен на популяции, склонной к высокому уровню случайного пребывания на солнце (студенты колледжей Южной Калифорнии). Исходное воздействие солнца и поведение по защите от солнца, наряду с соответствующими демографическими характеристиками, оценивались и, при необходимости, статистически контролировались в ходе анализа. Эксперимент включал оценку нескольких представлений о риске для здоровья и поведении в отношении здоровья, которые были связаны с различной степенью успеха с достижением модификации риска в других областях здоровья.Наконец, и, возможно, это самое важное, этот эксперимент вышел за рамки непосредственных поведенческих намерений, оценив сообщаемое поведение на солнце и защиту в течение месяца после вмешательства в «неожиданном» последующем телефонном разговоре.

Однако важно отметить, что эксперимент включал относительно небольшой размер выборки (особенно в отношении подгруппы, которая получила вмешательство и использовала образец солнцезащитного лосьона для загара), что ограничивает статистическую мощность.Кроме того, период наблюдения составил всего 1 месяц, что не позволяет определить долгосрочные последствия вмешательства. Кроме того, поскольку все результаты основаны на самоотчетах, невозможно исключить предвзятость ответов. Тем не менее, следует отметить, что предыдущая работа продемонстрировала значительную связь между самоотчетами и фактическим поведением по защите от солнца, 5 ,36 -38 , и все участники были осведомлены об изучаемых вопросах. То есть даже участники контрольной группы выполнили все измерения и были опрошены относительно общей цели исследования после первоначального сеанса в лаборатории.Если бы результаты были обусловлены просто спросом, можно было бы ожидать общих различий между экспериментальной и контрольной группами, а не наблюдаемой закономерности. Тем не менее, в будущей работе было бы желательно использовать более объективные поведенческие меры воздействия солнца (например, спектрофотометр). 20 Одна из проблем спектрофотометра в данном контексте, однако, заключается в том, что он не может отличить цвет кожи, который является результатом воздействия УФ-излучения, от лосьона для загара без солнца. Наконец, все участники были студентами колледжей Южной Калифорнии, что потенциально ограничивало возможности обобщения для других групп населения или других регионов страны.

Фотография с ультрафиолетовым фильтром используется как в коммерческих целях, так и многими практикующими дерматологами. 26 Однако на сегодняшний день было опубликовано только одно эмпирическое исследование, изучающее его влияние на поведение. 15 Настоящие результаты в сочетании с выводами Mahler et al, 15 показывают, что это вмешательство может значительно повлиять на поведение, о котором сообщают сами пациенты. Предполагая, что будущая работа подтвердит эффективность вмешательства с использованием более объективных показателей поведения, это вмешательство, основанное на внешнем виде, может иметь важное практическое применение.Ультрафиолетовые мгновенные камеры легко доступны, относительно недороги и просты в эксплуатации. Фактически, с моделью, используемой в этом эксперименте, люди могли легко делать свои собственные фотографии (уменьшая необходимость выделять время для фотографирования). Таким образом, кажется вероятным, что это вмешательство может быть предложено в большинстве дерматологических кабинетов, студенческих поликлиник и врачебных кабинетов.

Кроме того, вполне вероятно, что одобрение врачом или медсестрой солнцезащитного лосьона для загара как безопасной и эффективной альтернативы УФ-воздействию побудит больше людей попробовать его.Основываясь на тенденциях, наблюдаемых в этом эксперименте с небольшим процентом участников, которые пробовали лосьон для загара без солнца, это может привести к дополнительному поведению в отношении защиты от солнца. Конечно, для клиницистов было бы важно поощрять регулярное использование солнцезащитного крема и объяснять, что загар, полученный с помощью лосьона для загара без солнца, не обеспечивает защиту от солнца.

Статья

Адрес для переписки: Хайке И. М. Малер, доктор философии, факультет психологии 0109, Калифорнийский университет, Сан-Диего, Ла-Хойя, Калифорния ([email protected]образование).

Принято к публикации : 6 октября 2004 г.

Финансирование/поддержка: Это исследование было частично поддержано Калифорнийским государственным университетом, Сан-Маркос, грантом на исследования, стипендию и творческую деятельность, Калифорнийским государственным университетом, Сан-Маркос, грантом на развитие факультета Колледжа искусств и наук, грантом от Фонда исследования и профилактики рака, Александрия, штат Вирджиния, и грант CA от Национального института рака, Бетесда, штат Мэриленд.

Предыдущая презентация: Часть этих данных была представлена ​​на собрании Западной психологической ассоциации; 3-6 мая 2001 г.; Мауи, Гавайи; и собрание Общества поведенческой медицины; 19-22 марта 2003 г.; Солт-Лейк-Сити, Юта.

Подтверждение: Мы благодарим Ричарда Э. Фитцпатрика, доктора медицины, за его советы и помощь в этом проекте. Мы также благодарим Neutrogena Corporation, Лос-Анджелес, Калифорния; Dermatology Associates/Cosmetic Laser Associates of San Diego County Inc, Ла-Хойя, Калифорния; и Coppertone Inc, Кенилворт, Нью-Джерси, которые пожертвовали лосьон для загара и образцы солнцезащитного крема.

Раскрытие финансовой информации: Нет.

Примечание редактора : В то время как большинство дерматологов рекомендуют избегать воздействия УФ-излучения и использовать солнцезащитную одежду и солнцезащитные средства, эффективность образовательных мероприятий по профилактике рака кожи и их влияние на поведение при воздействии солнца недостаточно изучены. Однако было проведено несколько рандомизированных контролируемых испытаний образовательных вмешательств, в том числе в школах, на рабочем месте, в обществе и на пляжах.Критерии исхода включали использование солнцезащитных кремов, использование защитной одежды, избегание полуденного солнца или количество солнечных ожогов. Уэстон хорошо резюмировал состояние дел в области профилактики рака кожи. (Уэстон Р. Профилактика рака кожи. В: Williams HC, Bigby M, Diepgen T, Herxheimer A, Naldi L, Rzany B. Evidence-Based Dermatology . London, England: BMJ Books; 2003:273-284.) В настоящее время проводится систематический обзор для оценки эффективности образовательных программ, направленных на повышение осведомленности о раке кожи и солнцезащитном поведении.(Naldi L, Buzzetti R, Cecchi C, et al. Образовательные программы по профилактике рака кожи [Протокол] . Оксфорд, Англия: Кокрановская база данных систематических обзоров, том 4; 2004).

Майкл Э. Бигби, MD

Совместная работа Отделения клинической эпидемиологии Istituto Dermopatico dell’Immacolata Istituto di Ricovero e Cura a Carattere Scientifico (IDI-IRCCS) и Архива дерматологии

1.

Американское онкологическое общество, Рак в фактах и ​​цифрах Атланта, Джорджия, Американское онкологическое общество, 2002;

2. Хоу HLWingo PAТун МДж и другие. Ежегодный отчет для страны о состоянии рака (с 1973 по 1998 г.), в котором показаны раковые заболевания с недавними тенденциями роста J Natl Cancer Inst 2001; Дж.К.Ригель ДСАмонетте RA Тенденции в знаниях, отношении и поведении, связанных с воздействием солнца: с 1986 по 1996 год J Am Acad Dermatol 1997; 37179-186PubMedGoogle ScholarCrossref 4.Борланд РМХокинг Годкин Г.А. и другие. Влияние образовательного пакета по борьбе с раком кожи для работающих на открытом воздухе  Med J Aust 1991;154686- 688PubMedGoogle Scholar5.Buller DBBuller МКБич Б и другие. Солнечные дни, здоровые пути: оценка учебной программы по профилактике рака кожи для детей младшего школьного возраста J Am Acad Dermatol 1996; 35911-922PubMedGoogle ScholarCrossref 7.Mermelstein RJRiesenberg LA Изменение знаний и отношения к факторам риска рака кожи у подростков Health Psychol 1992; 11371-376PubMedGoogle ScholarCrossref 8.Миллер АГАштон WAMcHoskey ДжВ и другие. Какая ценовая привлекательность? стереотипы и факторы риска при загаре J Appl Soc Psychol 1990;201272-1300Google ScholarCrossref 9.Ramstack Дж.Л.Уайт SEHazelkorn К.С.Мейскенс FL Солнечный свет и рак кожи: школьный проект по профилактике рака кожи   J Cancer Educ 1986;1169–176PubMedGoogle ScholarCrossref 10.Robinson Дж. К. Модификация поведения, полученная в результате обучения защите от солнца в сочетании с удалением рака кожи Arch Dermatol 1990; 126477-481PubMedGoogle ScholarCrossref 11.Вайншток М.А.Росси JS The Rhode Island Sun Smart Project: научный подход к профилактике рака кожи   Clin Dermatol 1998;16411-413PubMedGoogle ScholarCrossref 12.Beasley ТМКиттель BS Факторы, влияющие на рискованное для здоровья поведение посетителей соляриев   Eval Health Prof 1997; Х.Дж.Дэвис БДМанте AF Практики избегания солнца среди белых калифорнийцев неиспаноязычного происхождения Health Educ Behav 1999; 26360-368PubMedGoogle ScholarCrossref 14.Турриси РХиллхаус ДжейГеберт C Изучение когнитивных переменных, связанных с солнечными ваннами   J Behav Med 1998;21299- 313 Х.И.Кулик JAGibbons Форекс и другие. Влияние вмешательства, основанного на внешнем виде, на намерения защищаться от солнца и поведение, о котором сообщают сами респонденты.  Health Psychol 2003; МБорланд Р.Гасон R Влияние загара на суждения подростков о здоровье и привлекательности J Appl Soc Psychol 1992; 22157-172Google ScholarCrossref 17.Джонс Дж.Лири MR Влияние основанных на внешнем виде предостережений против пребывания на солнце на намерения загорать у молодых людей Health Psychol 1994; 1386-90PubMedGoogle ScholarCrossref 19.Leary Мистер Джонс JL Социальная психология загара и использования солнцезащитных средств: мотивы самопрезентации как предиктор риска для здоровья ХИМФитцпатрик Би Паркер Плапин A Относительный эффект вмешательства, ориентированного на здоровье, и вмешательства, основанного на внешнем виде, направленного на увеличение использования солнцезащитных средств  Am J Health Promo 1997;11426- 429Google ScholarCrossref 21.Новик M Гореть или не гореть: использование компьютеризированных стимулов для поощрения применения солнцезащитных кремов  Cutis 1997;60105- 108 JSBlais LВайншток Массачусетс Проект Rhode Island Sun Smart: профилактика рака кожи достигает пляжей  Am J Public Health 1994;84672- 674PubMedGoogle Scholar23.Prentice-Dunn СДжонс Дж.Л.Флойд DL Убеждающие призывы и снижение риска рака кожи: роль заботы о внешнем виде, воспринимаемой пользы от загара и информации об эффективности  J Appl Soc Psychol 1997;271041–1047Google ScholarCrossref 24.Жаккар J Отношение и поведение: последствия отношения к поведенческим альтернативам J Exp Soc Psychol 1981;17286-307Google ScholarCrossref 25.Hillhouse JTurrisi РХолвиски Ф и другие. Исследование психологических переменных, имеющих отношение к склонности к искусственному загару J Health Psychol 1999; JE Использование ультрафиолетовой (УФ-обнаружение) камеры для улучшения видимости фотоповреждений и других кожных заболеваний  Dermatol Surg 1997;23163- 169PubMedGoogle Scholar27.Росси JSBlais LMRedding Калифорния и другие. Предотвращение рака кожи путем изменения поведения: последствия для вмешательств  Dermatol Clin 1995; 13613- 622 М.М.Лихтенштейн E Самоэффективность и рецидивы в программах отказа от курения J Consult Clin Psychol 1981;49648-658PubMedGoogle ScholarCrossref 29.Sallis Дж. Ф. Пински РБГроссман РМ и другие. Разработка шкал самоэффективности для диеты и физических упражнений, связанных со здоровьем  Health Educ Res 1988;3283- 292Google ScholarCrossref 30.

Кеппель G Дизайн и анализ: Справочник исследователя Englewood Cliffs, NJ Prentice-Hall, 1973;

32. Ньюман WGWoodruff СИАрго ADMayer JA Опрос жителей Сан-Диего, Калифорния  – Am J Prev Med 1996;12186- 194PubMedGoogle Scholar33.Maiman Л.Бекер MH Модель убеждений о здоровье: истоки и корреляции Беккер MHed   Модель убеждений о здоровье и личное поведение Thorofare, NJ Slack Inc., 1974; Google Scholar35.Роджерс RW Когнитивные и физиологические процессы при изменении отношения, основанного на страхе: пересмотренная теория защитной мотивации Cacioppo ДжедПетти Red   Социальная психофизиология: справочник New York, NY Guilford, 1983; Google Scholar36.Girgis ASanson-Fisher RWTripodi Д.А. и другие. Оценка мероприятий по улучшению защиты от солнца в начальных школах Health Educ Q 1993; 20275-287PubMedGoogle ScholarCrossref 37.Гиргис ASanson-Fisher Р.В.Уотсон A Вмешательство на рабочем месте для увеличения использования солнечной защиты работниками на открытом воздухе   Am J Public Health 1994;8477- 81PubMedGoogle ScholarCrossref 38.Mayer JASallis JFEckhardt л и другие. Оценка воздействия ультрафиолетового излучения на детей: использование воспоминаний родителей посредством телефонных интервью Am J Public Health 1997; 871046-1049PubMedGoogle ScholarCrossref

Сорт сои SCEL-1 демонстрирует сильное действие против фотостарения в трехмерной модели кожи человека и безволосых мышей, индуцированной УФ-излучением | Прикладная биологическая химия

Растительные материалы

Три сорта черной сои, SCEL-1, CJ-3 и WH, были переданы в дар Национальным институтом растениеводства Кореи.Три соевых боба выращивали на поле в Паджу, Корея, с мая по октябрь 2017 года. Соевые бобы высушивали на воздухе и хранили при температуре 10 °C в темноте до использования. Все культурные растения содержались в основном в соответствии с обычными методами ведения сельского хозяйства в соответствии со стандартным протоколом Управления развития сельских районов (http://www.nongsaro.go.kr/), включая орошение, внесение удобрений и борьбу с вредителями.

Экстракция

Экстракцию сои проводили в соответствии с предыдущим отчетом с небольшими изменениями [19].Высушенные соевые бобы измельчали ​​в порошок, пропускали через сито 60 меш, 3 г полученного порошка смешивали с 70% водным раствором этанола и обрабатывали ультразвуком в течение 15 мин. Затем раствор, содержащий соевый порошок, выдерживали при комнатной температуре в темноте примерно в течение 14 часов. Наконец, раствор снова обрабатывали ультразвуком в течение 15 мин. Экстрагированный раствор пропускали через фильтровальную бумагу (Hyundai Micro, размер 300 мм, марка № 100, Сеул, Южная Корея) и этанол из экстрагированного раствора выпаривали с помощью испарителя SpeedVac (Thermo Fischer Scientific, модель SPD2010-220, Waltham , Массачусетс, США).Оставшийся раствор полностью высушивали с использованием лиофилизатора (Operon, модель FDCF-12003, Gimpo, Gyeonggi-do, Южная Корея). Конечный экстрагированный порошок хранили при 4 °C до использования.

Трехмерная модель кожи и клеток человека

Трехмерная (3D) полнослойная модель кожи человека (EpiDermFT™) была приобретена у MatTek Corporation (Ашленд, Массачусетс, США). Эквивалент кожи поддерживали в модифицированной Дульбекко среде на основе Игла (DME), поставляемой производителем (EFT-300-MM), при 37 °C и 5% CO 2 .Нормальные кожные фибробласты человека (HDF) были получены от Lonza (Walkersville, MD, USA) и культивированы в среде Игла, модифицированной Дульбекко (DMEM; Invitrogen, Карлсбад, Калифорния, США), с добавлением 10% фетальной бычьей сыворотки (FBS; HyClone Laboratories Inc. , Логан, Юта, США) и 1% пенициллин/стрептомицин (Invitrogen) при 37 °C и 5% CO 2 .

УФ-облучение

В качестве источника УФ-излучения использовалась флуоресцентная УФ-лампа (Sankyo Denki G15T8E, Sankyo Denki, Япония) со спектром излучения от 280 до 360 нм с пиком 312 нм.Эквиваленты кожи человека обрабатывали каждым реагентом в течение 1 часа, облучали УФ-В при 40 мДж/см 2 и впоследствии заменяли реагенты в бессывороточной среде на 72 часа. Клетки высевали в 6-луночные планшеты, инкубировали в течение 24 ч, промывали PBS и добавляли бессывороточную среду. Через 24 часа клетки предварительно обрабатывали каждым реагентом в течение 1 часа перед УФ-облучением. Общая энергетическая доза УФ-В облучения была установлена ​​на уровне 20 мДж/см 2 для оптимизации жизнеспособности клеток и стимуляции ММР-1. После этого клетки облучали УФВ и обрабатывали реагентами в бессывороточной среде в течение 48 ч.

Иммуноферментный анализ (ИФА)

Супернатанты кожных эквивалентов собирали и подвергали ИФА. Секрецию MMP-1 и проколлагена типа I количественно определяли из супернатантов с использованием набора ELISA для человеческого MMP-1 и проколлагена типа I (R&D Systems, Миннеаполис, Миннесота, США). Относительные уровни MMP-1 и проколлагена типа I нормализовали к соответствующей жизнеспособности клеток, измеренной с помощью анализа МТТ (Ez-cytox, Dail Lab Service. Co., Сеул, Корея).

Эксперименты на животных

Голые мыши SKH-1 (самки, возраст семь недель) были приобретены у Orient Bio Inc.(Соннам, Корея). Все экспериментальные процедуры с участием животных соответствовали Руководству по уходу и использованию лабораторных животных Национального института здравоохранения (публикация NIH № 85-23, редакция 2011 г.). Процедуры были одобрены Институциональным комитетом по уходу и использованию животных (IACUC) Корейского института науки и технологий (номер сертификата KIST-2016-011). SCEL-1, CJ-3 и WH (25, 50 или 100 мг/кг/день) в растворе носителя (0,5% карбоксиметилцеллюлозы) перорально вводили бесшерстным мышам в течение 8 недель в условиях воздействия УФ-излучения.Протоколы УФ-облучения выполняли следующим образом. В течение первой недели на спину безволосых мышей наносили УФ-дозу, равную 1 минимальной эритемной дозе (MED), соответствующей 100 мДж/см 2 . Интенсивность увеличивалась на 1 МЭД каждые 2 недели на срок до 8 недель. В конце эксперимента мышей облучали 4 МЭД.

Создание реплик и анализ изображений

Изображение кожи спины каждой мыши было получено сразу после окончания эксперимента.Затем с использованием смолы SILFLO (Cuderm, Даллас, Техас, США) получали реплики кожи спины умерщвленных мышей. Анализ изображений реплик был выполнен Центром разработки новых лекарств Фонда медицинских инноваций Тэгу-Кёнбук (Тэгу, Корея). Степень сморщивания оценивали с помощью анализа тени с помощью Visioline VL650 (Courage + Khazaka, Кельн, Германия), который содержал камеру, предметный столик и светодиодный источник света, светящий под углом 35° к столику. Степень морщин выражается как среднее значение фактора, определяемого как среднее отношение ширины к длине всех теней, рассматриваемых как морщины.Значение 0 указывает на идеальный круг, а 1 указывает на идеальную линию. Следовательно, чем ближе значение к 1, тем эффективнее оно предотвращает появление морщин [20].

Препарат ткани для микроскопии и гистологии

Образцы кожи спины мыши фиксировали в 3,7% растворе формальдегида и заливали в парафиновые блоки. Серийные срезы получали с помощью микротома, сушили и окрашивали несколькими красителями, такими как гематоксилин и эозин (H&E), трихром Массона (MT) и толуидиновый синий (TB).Гистологический вид исследовали с помощью микроскопа Olympus CX31/BX51 (Olympus Optical Co., Токио, Япония) и камеры TE-2000U (Nikon Instruments Inc., Мелвилл, штат Нью-Йорк, США). Толщину эпидермиса оценивали путем измерения длины от рогового слоя до базального слоя с помощью линейки, оснащенной микроскопом, и программы LAS v4.8 (Leica Microsystem, Herbrugg, Швейцария).

Анализ изофлавонов и других флавоноидов

Высушенный экстракт растворяли в ДМСО с концентрацией 5 мг/мл и проводили количественный анализ 5 основных изофлавонов в каждом экстракте с использованием системы ВЭЖХ Agilent 1200 (Agilent Technologies, Санта-Клара, Калифорния, США), оснащенный детектором с диодной матрицей (DAD) G1315A на длине волны 254 нм.Хроматографическое разделение было достигнуто с использованием обращенно-фазовой колонки Luna C18 (4,6 × 150 мм, 5 мкм, Phenomenex, Торранс, Калифорния, США) и двух систем растворителей: A (100 % воды, содержащей 0,05 % муравьиной кислоты) и B (100 % ацетонитрила, содержащего 0,05% муравьиной кислоты), при скорости потока 1 мл/мин. Использовали градиент от 10 до 100% B в течение 30 мин. Количественное определение 5 основных изофлавонов было выполнено на основе площади УФ-пика стандарта дайдзина в сочетании с молярными коэффициентами экстинкции, и были построены калибровочные кривые по восьми точкам для дайдзина при концентрациях от 0.от 01 до 10 мкг/мл.

Высушенный экстракт растворяли в 1 мг/мл в ДМСО, содержащем 2 мкг/мл флоридзина в качестве внутреннего стандарта, и проводили количественный анализ двух флавоноидов в каждом экстракте с использованием настольного гибридного квадрупольно-орбитального масс-спектрометра Q-Exactive (Thermo Fisher Scientific, Уолтем, Массачусетс, США), оснащенный сверхвысокоэффективной жидкостной хроматографией Vanquish (Thermo Fisher Scientific, Уолтем, Массачусетс, США). Пять микролитров введенного образца разделяли с помощью колонки с обращенной фазой Kinetex C18 (2.1 × 100 мм, 2,6 мкм, 100 Å, Phenomenex, Торранс, Калифорния, США) и две системы растворителей, A (95% воды и 5% ацетонитрила; 0,1% муравьиной кислоты) и B (5% воды и 95% ацетонитрила; 0,1% муравьиной кислоты), при скорости потока 0,35 мл/мин. Линейный градиент использовали следующим образом: 3% B в течение 1 мин, от 3 до 100% B в течение 10 мин и 100% B в течение 2 мин. Колонку поддерживали при комнатной температуре и повторно уравновешивали в течение не менее 5 мин между анализами. Отделенный образец ионизировали путем подачи высокого напряжения + 3,2 кВ на источник ионизации с подогревом и электрораспылением (HESI) с защитным газом 42 и вспомогательным газом 10 для стабилизации ионизации.Ионизированный образец перемещали через капиллярную трубку для переноса при 320 °C, и все перемещаемые ионы регистрировали с использованием режима сбора данных, зависящего от 10 лучших (DDA). Подробные параметры DDA были следующими: в полной МС данные были получены с разрешением 70 000, и ионы переносились с помощью целевого значения автоматического регулирования усиления (АРУ) 1e6, максимального времени ввода (макс. IT) 100 мс и диапазона сканирования. 150–2000 м/з. Данные MS2 были получены при разрешении 17 500, целевом значении AGC 2e5, максимальном IT 50 мс, изолированном окне и нормализованной энергии столкновения (NCE) 2.0 и 30 м/з. Процианидин B2 и эпикатехин количественно определяли на основе калибровочной кривой для десяти различных концентраций от 0,01 до 1 мкг/мл с использованием отношения площади пика МС каждого соединения к внутреннему стандарту.

Все пики, полученные с помощью ВЭЖХ, были обработаны с использованием программного обеспечения ChemStation (Rev. B.02.01-SR1, Agilent Technology, Санта-Клара, Калифорния, США), а необработанные данные, полученные с помощью ЖХ-МС/МС, были обработаны с помощью программного обеспечения Qual Browser, предоставленного пакет Xcalibur (Thermo Fischer Scientific, Уолтем, Массачусетс, США, вер.4.1.3). Стандартные химикаты были приобретены у Sigma-Aldrich (Сент-Луис, Миссури, США).

Иммуноблоттинг

Целые супернатанты клеток осаждали 10% трихлоруксусной кислотой, а клеточные лизаты готовили в лизирующем буфере (Cell Signaling Technology, Danvers, MA, USA), содержащем ингибитор протеазы (Roche, Penzberg, Germany) и фосфатазу. коктейль ингибиторов (Sigma-Aldrich). Затем определяли концентрацию белка в каждом образце с использованием набора для анализа QuantiPro™ BCA (Sigma-Aldrich).Белки в супернатантах и ​​лизатах подвергали электрофорезу в 8% гелях SDS-PAGE и переносили на поливинилиденфторидные мембраны (Millipore, Billerica, MA, USA). Затем мембраны исследовали первичным антителом против MMP-1 (Calbiochem, Массачусетс, США) в течение 24 часов при 4 °C и выявляли с помощью соответствующих вторичных антител, конъюгированных с пероксидазой хрена, при комнатной температуре в течение 1 часа. Хемилюминесценцию определяли с использованием субстрата максимальной чувствительности SuperSignal® West Femto (Pierce, Rockford, IL, USA) и визуализировали с помощью iBrtight FL1500 (Invitrogen, CA, USA).

Статистический анализ

Данные выражены в виде средних значений ± SD. Различия между средними значениями в двух группах были проанализированы с использованием однофакторного дисперсионного анализа (ANOVA) и апостериорного анализа множественных сравнений Тьюки. P < 0,05 считалось статистически значимым.

Эффект против фотостарения ферментированных побочных продуктов сельского хозяйства на коже безволосой мыши, облученной ультрафиолетом В

Введение

Зеленый рост – это процесс, направленный на поддержание устойчивого развития при сохранении и улучшении глобального Окружающая среда; таким образом, это представляет большой социальный интерес и значение (1).Неотъемлемая часть достижение зеленого роста предполагает переработку сельскохозяйственных отходов образующиеся при производстве сельскохозяйственной продукции (2). Побочные продукты сельскохозяйственного действия прекращаются на этапах обработки. Эти заброшенные побочные продукты сельского хозяйства являются богатыми источниками различных функциональные материалы и в настоящее время активно оцениваются за их эффективность (3). Предыдущие исследования сосредоточились на ценных побочных продуктах сельского хозяйства и биоэнергетика (4) и экологически чистые материалы (5), где функциональное улучшение с помощью биоконверсии является репрезентативным пример.Таким образом, настоящее исследование было направлено на проведение процесс биоконверсии (ферментация) для увеличения использования биоресурсы в производстве функциональных пищевых материалов.

Биоконверсия — это метод, который используется для производства желаемого продукта из конкретных прекурсоров с помощью микроорганизмы. включает в себя биопроцессы, биосинтез и биокатализ (6). Разница между биоконверсией и обычным процессом ферментации что последний начинается с простого сырья, тогда как первый производит продукт из прекурсоров, используя селективность микробный или ферментативный субстрат (7).В связи с этим биоконверсия Процесс представляет собой передовую энергосберегающую технологию (8). Процесс биоконверсии может особенно способствовать повышению удобства использования и эффективности в развитие фармацевтики и косметики (9). В предыдущем исследовании было подтверждено что биоконверсия увеличила производство активных ингредиентов включая соединения β-глюкана и γ-оризанола в рисовых отрубях, и соединения лигнана в кунжутном жмыхе (10). Кроме того, было подтверждено, что гликозиды соевого жмыха (дайдзин, глицитин и генистин). превращаются в агликоны (даидзеин, глицитеин и генистеин) (11).Кроме того, биоконверсия повышает антиоксидантную активность рисовых отрубей, соевого жмыха и кунжутного жмыха и изменили противоаллергическую активность кунжутный пирог (12).

Кожа – самый большой орган тела, который контролирует выведение метаболитов и температуру тела. это постоянно подвергается воздействию внешней среды и защищает организм от внешних раздражителей (13). Ультрафиолетовые (УФ) лучи, типичный внешний раздражитель, имеют благотворное влияние на синтез и стерилизацию витамина D (14,15).Хотя ультрафиолетовое излучение через достаточное пребывание на солнце, необходимо для человека, высокая частота внешней деятельности и длительного воздействия УФ-лучей может привести к при старении кожи (16).

В зависимости от длины волны ультрафиолетовый свет можно классифицировать как UVA (320–400 нм), UVB (290–320 нм) или UVC (200–290 нм) (17). Озоновый слой в атмосфере полностью поглощает УФ-лучи; однако лучи UVA и UVB проникают до поверхности Земли (18). Чрезмерное воздействие УФВ, в в частности, вызывает изменения в эпидермисе (19).Фотоповреждение кожи характеризуется развитием эритемы, отека, гиперплазии, гиперпигментация, солнечные ожоги, сухость, снижение эластичности и образование морщин (20). Кроме того, старение кожи может происходить из-за повышенного содержания активного кислорода. производство видов (АФК) в коже, вызванное УФ-В. Хотя кожа разработала систему защиты от АФК, непрерывное производство АФК нарушает ферментативную и неферментативную система антиоксидантной защиты кожи (21). Кроме того, УФБ усугубляет воспалительный ответ, активируя и стимулируя воспалительный клеточная инфильтрация, вызывающая повреждение кожи (22).АФК, генерируемые УФБ, могут влиять митоген-активируемая протеинкиназа (MAPK) сигнализирует и активирует ядерный фактор-κB и белок активации 1 для высвобождения воспалительного цитокины, включая фактор некроза опухоли-α (TNF-α), интерлейкин (ИЛ)-1β и ИЛ-6 (23). В Кроме того, увеличение активности матриксной металлопротеиназы (ММП) в ответ на продукцию АФК приводит к разрушению структура и функция внеклеточного матрикса (ECM) через деградация коллагена (24). УФ Воздействие также стимулирует выработку циклооксигеназы-2. (ЦОГ-2), который усугубляет воспаление кожи, катализируя синтез простагландина Е2 и индукция экспрессии индуцируемая синтаза оксида азота (iNOS), которая может привести к кожным воспаление (25).

Однако современный образ жизни людей из Различные возрастные группы уделяют большое внимание здоровью кожи и красота (26). Количество косметика и продукты питания были разработаны, чтобы отсрочить и предотвратить процесс старения и для поддержания здоровья кожи (27,28). Исследование, направленное на облегчение и улучшение морщин кожи в настоящее время выполняется (29). Следовательно, это достойные усилия по повышению стоимости сельскохозяйственной продукции при этом удовлетворяя потребности современного человека.Настоящее исследование было было предпринято для изучения эффекта против фотостарения ферментированных побочные продукты сельского хозяйства, включая ферментированные рисовые отруби (FRB), соевый жмых (FSB) и кунжутный жмых (FSC) на УФ-облучении безволосая мышиная кожа.

Материалы и методы
Уход за животными и УФ-облучение

Семинедельные самки бесшерстных мышей HR-1 (масса, 27,9-33,8 г) были предоставлены Центральной лабораторией. Animal Inc. (Сеул, Корея). Испытание было одобрено с этической точки зрения Комитет по уходу за животными и их использованию Канвонского национального университета (утверждение №.КВ-170417-1; 15 мая 2017 г.). Эти мыши (n=30) были случайным образом разделены на шесть групп по пять животных в группе (Таблица I). Они были размещены в помещение с климат-контролем (22°C при влажности 50%) через 12/12 ч циклы свет/темнота. Все мыши имели свободный доступ к вода и еда. Пероральное введение ФРБ, ФСБ и ФСБ, которые растворяли в 500 мкл носителя (физиологический раствор) и вводили один раз в день в течение 8 недель, рассчитывали и проводят в зависимости от массы тела мышей. Для того, чтобы уравнять условия с группами обработки образцов, УФБ группе носителя перорально вводили только носитель.Тело вес каждой мыши измеряли каждую неделю. Продовольственная эффективность ставка была рассчитана и выражена в процентах с использованием по следующей формуле: Коэффициент пищевой эффективности (%) = [общая прибавка в весе (г)/общее потребление пищи (г) × 100]. УФ-лампа, оснащенная 100 мкВт/см2 УФ-лампа с максимальным излучением использовали длину волны 312 нм (Jiatian Trading Co., Ltd.). К определяют 1 минимальную эритемную дозу (МЭД) на коже спины мыши подвергались воздействию различных доз УФ-излучения и эритемы. образование было обнаружено через 24 часа.Старение кожи проводилось с помощью 1 Облучение МЭД три раза в неделю в течение 8 недель. Безволосые мыши HR-1 облучали 100 мДж/см2 УФ-излучения (1 МЭД=100 мДж/см2) ежедневно в течение первой недели, затем Облучение УФБ три раза в неделю по 200 мДж/см2 со 2-й недели до 8. Через 8 недель после окончания лучевой терапии, носитель, местно применяемая 0,01% ретиноевая кислота (каталожный номер R2625; Сигма-Олдрич; Merck KGaA, Дармштадт, Германия), ФРБ, ФСБ и ФСБ лечение было начато, и животные были немедленно умерщвлены. использование газа CO2 для получения образцов тканей кожи.

Таблица I

Дизайн и лечение HR-1 голых группы мышей.

Таблица I

Дизайн и лечение HR-1 голых группы мышей.

Группы Лечение Номер
HR-1 нормальный HR-1 без каких-либо обработка (контроль) 5
средство УФВ облучение УФВ транспортное средство 5
УФБ РА УФБ + 0.01% ретиноевая кислота (мазь для местного применения) 5
UVB FRB UVB + FRB 40 мг/кг (пероральный) 5
УФБ ФСБ УФБ + ФСБ 40 мг/кг (пероральное введение) 5
UVB FSC UVB + FSC 40 мг/кг (пероральный прием) 5
Подготовка ФРБ, ФСБ и ФСБ

Образцы, использованные в настоящем исследовании, были предоставлены компанией STR Biotech Co., Ltd. (Чхунчхон, Корея). Рис, соя и Семена кунжута были собраны в Геочане, Корея, в августе 2014 г. и октябрь 2014 г. Образцы были идентифицированы доктором Си Кван О в Национальный институт растениеводства (Мильян, Корея). Это были ферментированный Lentinula edodes (грибами шиитаке) с использованием система ферментации. Ферментацию проводят, как и раньше. описан (12). Короче, Л. edodes были выделены из плодового тела гриба и культивировали в среде картофельно-декстрозного агара (PDA) (Difco; BD Biosciences, Франклин Лейкс, Нью-Джерси, США).Генетическая идентичность грибок был подтвержден Корейским центром микроорганизмов (Сеул, Корея). Мицелий, выращенный на среде PDA, засевают в 50 мл жидкой среды, содержащей 2 % глюкозы, 0,5 % дрожжевого экстракта, 0,5 % соевый пептон, 0,2% монофосфата калия (Х3ПО4), 0,05% сульфат магния (MgSO4) и 0,002% сульфата железа (FeSO4). Эксперименты проводились в колбах Эрленмейера вместимостью 250 мл при 28°С. в течение 5 дней на роторном шейкере, а полученный бульон использовали для посев основной жидкой культуры.Жидкие питательные среды, содержащие побочные продукты сельского хозяйства (рисовые отруби, соевый жмых и кунжутное семя торт) обрабатывали амилазой и целлюлазой при 60°С в течение 60 мин до ферментативно переваривать суставные материалы, содержащие углеводы. Затем культуральную массу корректировали путем доведение pH до 6,0 с помощью соляной кислоты (HCl), с последующим стерилизация в автоклаве. Дальнейшие эксперименты проводились в ферментере объемом 5 л (рабочий объем 3 л) при 28°C и 1050 × г по засев среды культивируемым мицелием (10%).Последующий до 7 суток культуру обрабатывали смесью ферментов содержащие целлюлазу, гемицеллюлазу, пектиназу, глюканазу, манназу и арабиназу (Sigma-Aldrich; Merck KGaA) при 50°C в течение 60 мин до лизируют клеточные стенки. Обработанную ферментом культуральную массу экстрагировали. при 90°С в течение 1 часа и лиофилизации с получением порошка.

Измерение образования морщин

Степень старения кожи, вызванного УФ-В, была измерена с помощью исследование образования морщин. Безволосые мыши HR-1 были обезболивают внутрибрюшинными инъекциями 0.1 мл 8% хлораля гидрат (320 мг/кг) до 8 недель с 2-недельными интервалами, после чего была сфотографирована область спины, облученная УФ-В, на увеличение в 400 раз с использованием цифрового оптического USB-микроскопа. Кожные морщины исследовали с помощью DETAX System 2 и Double-Stick Dis (3M Deutschland GmbH, Вальхайм, Германия). морщины также были проанализированы с помощью анализатора морщин Dermo Bella. (Chowis Co. Ltd., Соннам, Корея). Оценивали образование морщин в соответствии с системой оценки, установленной Bissett et al. (30): класс 0, не грубый морщины; 1 степень, несколько неглубоких грубых морщин; 2 класс, некоторые грубые морщины; и степень 3, несколько глубоких грубых морщин.

Измерение трансэпидермальной потери воды (TEWL)

TEWL был измерен в соответствии с ранее сообщенным метод (30). Мыши были хранится в помещении с климат-контролем (22°C и влажность 50%) в течение 30 минут. Кожу спины каждой мыши исследовали с помощью Зонд Corneometer® CM825 (Courage + Khazaka electronic GmbH, Кельн, Германия), которая находилась в тесном контакте с поверхность кожи спины и слегка надавливают, чтобы зафиксировать кожу содержание влаги.

Измерение β-глюкозидазы деятельность

Для измерения активности β-глюкозидазы эпидермис измельчали ​​с использованием фосфатно-солевого буфера (1x, pH 7.2) с добавлением 100 мкМ фенилметансульфонилфторида (PMSF) и центрифугировали при 10000×g в течение 5 мин при 4°C. отделенный супернатант реагировал с цитратно-фосфатным буфером (pH 5.6, 5 мМ таурохолата натрия), содержащий 4-метилумбеллиферий-β-D- глюкопиранозид (4-МУГ) при 37°С в течение 60 мин. Реакция была завершали добавлением 200 мМ карбонатно-бикарбонатного буфера (pH 10,5) и интенсивность флуоресценции 4-метилумбеллиферона (4-МУ) превращенного из 4-MUG измеряли с помощью спектрофлуориметра. (Хитачи, ООО, Токио, Япония) при возбуждении и излучении с длинами волн 360 и 450 нм соответственно. 4-МУ концентрации в диапазоне от 0 до 300 нМ использовали в качестве стандарта для измерения флуоресценции.

Анализ гистологического окрашивания

Был проведен гистологический анализ для определения толщина эпидермиса, структура коллагеновых волокон и тучных клеток. Ткани кожи спины из каждой экспериментальной группы фиксировали в 10% случаев. формалина при 21°С в течение 48 часов. Они были промыты, обезвожены, пропитаны и встроены с помощью станции для заливки парафином (Leica Microsystems GmbH, Вецлар, Германия).Гематоксилин и эозин (H&E) окрашивание (каждая 25°C в течение 3 и 1 мин соответственно) проводится для измерения толщины эпидермиса. Трихром Массона (MT) и окраска толуидиновым синим (каждая 25°С в течение 10 и 30 мин, соответственно) также использовались для анализа коллагенового волокна структура и инфильтрация тучных клеток соответственно.

Измерение ММП-2 с помощью твердофазный иммуноферментный анализ (ИФА)

Для измерения уровня экспрессии белка MMP-2 в ткани спинной кожи, извлеченные из бесшерстных мышей HR-1, MMP-2 Набор ELISA (QC126; R&D Systems, Inc., Миннеаполис, Миннесота, США) был используется в соответствии с протоколом производителя. Образцы тканей кожи гомогенизировали в течение 2 минут на льду с помощью Tissue-Tearor (BioSpec Products, Inc., Бартлсвилль, Оклахома, США) и ресуспендировали в 100 мг/мл. Трис-буферный физиологический раствор (1x, pH 7,6), содержащий 1 мМ PMSF, 1 мМ ЭДТА и ингибиторы протеазы (Sigma-Aldrich; Merck KGaA). гомогенаты центрифугировали при 10000×g в течение 30 мин при 4°С. К определить концентрацию белка, набор для анализа белка Брэдфорда (Био-Рад Лабораториз, Инк., Геркулес, Калифорния, США) использовали в соответствии с протоколу производителя. Набор MMP-2 ELISA использовался для измерить экспрессию белка и моноклональное антитело, специфичное для Тотальную ММР-2 предварительно наносили на 96-луночный микропланшет. 200 В лунки добавляли мкл разбавителя для анализа и инкубировали при комнатной температуре в течение 1 ч. После разбавления стандарта раствора и супернатантов 20 раз, микропланшет промывали, с последующим добавлением 100 мкл стандарта и супернатанта в каждую лунку и инкубирование в течение 2 ч при комнатной температуре.Плита далее инкубировали при комнатной температуре в течение 1 ч при 200 мкл антитела, меченного биотином (детектирующее антитело), ​​затем обработка 200 мкл тетраметилбензидинового субстрата раствора в течение 1 ч при комнатной температуре в темноте. Стоп-решение было добавляли в каждую лунку и измеряли оптическую плотность при 450 нм, используя микропланшетный спектрофотометр. Все антитела и растворы используемые для измерения уровня белка MMP-2, были включены в MMP-2 набор ИФА.

Измерение ММР и цитокинов с использованием обратная транскрипция — количественная полимеразная цепная реакция (ОТ-кПЦР)

RT-qPCR проводили путем модификации ранее опубликованный протокол (25) к определить влияние FRB, FSB и FSC (40 мг/кг) на MMPs (ММП-2,9,3 и 13) и связанные с воспалением цитокины, включая TNF-α, COX-2, iNOS, IL-6 и IL-1β.Суммарная клеточная РНК была экстрагируют из кожных тканей фенол-хлороформным методом с использованием РНКазол (Tel-Test, Inc., Френдсвуд, Техас, США). Короче 3 мкг общей РНК использовали для синтеза кДНК с использованием ReverTra Набор Ace® qPCR RT (Toyobo Life Science, Осака, Япония). Система быстрой ПЦР в реальном времени 7500 (Applied Biosystems; Thermo Fisher Scientific, Inc., Уолтем, Массачусетс, США) использовали для RT-qPCR. (согласно протоколу производителя) вместе с праймером последовательности, упомянутые в Таблице II. Для этого использовали зонды TaqMan, содержащие краситель карбоксифлуоресцеин. определяют экспрессию мРНК.Набор зондов GAPDH мыши (номер по каталогу 4352339E, Зонд VIC/MGB, Primer Limited; прикладные биосистемы; Термо Fisher Scientific, Inc.) использовали в качестве внутреннего стандарта. конечная концентрация праймера составляла 200 нМ. Стандартный ПЦР условия: 50°С в течение 2 мин и 94°С в течение 10 мин, затем 40°С. циклы 94°С в течение 1 мин и 60°С в течение 1 мин. Количество циклов при котором интенсивность излучения образца превышала базовое значение представляло относительное количество (RQ), которое было пропорциональна целевой концентрации.Значение RQ целевая группа использовалась в качестве внутреннего контроля и кратности изменений в относительное обилие транскриптов рассчитывали с помощью 2-∆∆cq-метод (31).

Таблица II

Последовательности праймеров для обратного транскрипционно-количественный анализ полимеразной цепной реакции.

Таблица II

Последовательности праймеров для обратного транскрипционно-количественный анализ полимеразной цепной реакции.

Целевой ген Последовательности (5′-3′)
ММП-2 Ф: CAGGGAATGAGTACTGGGTCTATT
Ч ACTCCAGTTAAAGGCAGCATCTAC
MMP-3 Ф: TGGACCTGGAAATGTTTTGG
Р: ATCAAAGTGGGCATCTCCAT
MMP-9 Ф: AATCTCTTCTAGAGACTGGGAAGGAG
Р: AGCTGATTGACTAAAGTAGCTGGA
MMP-13 Ф: CCTCTTCTTCTCCGGAAACC
Р: GGTAGTCTTGGTCCATGGTATGA
TNF-α F: TTTGTCTACTGAACTTCGGGGTGATCGGTCC
Р: GTATGAGATAGCAAATCGGCTGACGGTGTGGG
COX-2 F: AGTGATCGAAGACTACGTGCAA
Р: GGGATTTCCCATAAGTCCTTTC
iNOS F: CGAAACGCTTCACTTCCA
Р: TGAGCTATATTGCTGTGGCT
Ил-6 Ф: TCCAGTTGCCTTCTTGGGAC
Р: GTGTAATTAAGCCTCCGACTTG
IL-1β F: CAACCAACAAGTGATATTTCCCATG
Р: AGATCCACACTCTCAGCTGCA
GAPDH Ф: GTGAGGCCGGTGCTGAGTAT
Р: CATCCTGCACCACCAACTGCTTAGCC
Статистический анализ

Статистический анализ был выполнен с использованием статистический пакет SPSS версии 24.0 (IBM Corp., Армонк, Нью-Йорк, США). Для непрерывных переменных проверялась нормальность. Соответствующий непараметрический критерий был выбран для переменных, обычно не распределенный. Односторонний дисперсионный анализ и критерии Крускала-Уоллиса использовались для сравнения нескольких групп с синдромом Шеффе и Апостериорные сравнения Бонферрони соответственно. Результаты были выражается как среднее значение ± стандартное отклонение. Р<0,05 был расценивается как указание на статистически значимое различие.

Результаты
Воздействие ФРБ, ФСБ и ФСБ на организм коэффициент веса и пищевой эффективности

Массу тела измеряли еженедельно с 1 по 8 неделю (Рис.1А). Никаких существенных разница в средней массе тела мышей наблюдалась между шесть групп через 3 недели. Начальная средняя масса тела в нормальная контрольная группа составила 28,7±0,66 г, что было ниже по сравнению с что и у других групп. Тем не менее, группа транспортных средств UVB продемонстрировала нет существенной разницы в массе тела по сравнению с другие группы после 3 недель. Оценка еды коэффициент эффективности [общая прибавка в весе (г)/общее потребление пищи (г) × 100] не выявили существенных различий между нормальным контролем группа и группы, облученные УФВ, в течение 8 экспериментальных недель (Рис.1Б). Все с УФ-облучением группы достоверно не отличались от группы нормальная контрольная группа; однако средние значения снизились до 1,03 ± 0,42% после обработки УФ-В от 2,37 ± 1,19 (контрольная группа). Кроме того, потребление групп FRB, FSB и FSC (40 мг/кг) было снизился до 0,72±0,36, 0,40±0,36 и 0,82±0,74% соответственно.

Ингибирование морщин, вызванных УФ-В излучением формирование ФРБ, ФСБ и ФСБ

Для измерения эффекта FRB, FSB и FSC (40 мг/кг каждый) при образовании морщин бесшерстных мышей HR-1 облучали UVB в области спины в течение 8 недель, чтобы вызвать фотостарение.Кожа глубина морщин измерялась с помощью анализатора Dermo Bella 3D (рис. 2). Образование морщин и наблюдалось значительное увеличение глубины из-за фотостарения (P<0,001) в группе носителя UVB (18,60±1,52) при сравнении с нормальной группой (4,60±0,89). Однако группа, получавшая лечение ретиноевая кислота показала значительное снижение (P<0,001) Значение клинического индекса Dermo Bella (10,20±1,48) по сравнению с Группа транспортных средств UVB. Пероральное введение ФРБ, ФСБ и ФСБ (40 мг/кг) также снижал клинический индекс Dermo Bella до 12.6±1,52, 13,00±1,58 и 14,40±1,67 соответственно.

Влияние FRB, FSB и FSC на TEWL и Активность β-глюкозидазы

Роговой слой кожи является самым наружным слой, предотвращающий чрезмерную потерю влаги телом. Он состоит из 10-20% влаги, что предотвращает появление на поверхности кожи от высыхания и уменьшает аномалии кожного барьера (32,33). Церамид представляет собой липидный компонент, составляет роговой слой и, как известно, имеет кожу увлажняющий эффект, в то время как β-глюкозидаза является ферментом, который регенерирует церамид из гликозилцерамида и ацила гликозилцерамид (34,35).Таким образом, содержание влаги в роговой слой — это показатель, используемый для мониторинга повреждения кожи. К оценить защитный эффект FRB, FSB и FSC (40 мг/кг) против потери воды была обработана УФБ-облученная спинная кожа мышей. проанализировано. Как представлено на рис. 3А, облучение УФВ вызывало 3,3-кратное увеличение ТЭПВ в кожи по сравнению с нормальной группой. Однако ретиноевая кислота лечение снизило значение ТЭПВ в 1,3, 1,2 и 1,3 раза у мыши, которым перорально вводили FRB, FSB и FSC соответственно по сравнению с группой носителя UVB.В качестве индекс для оценки старения кожи в настоящем исследовании. Как представлено в Рис. 3B, активность β-глюкозидазы снижается в 4,0 раза после облучения УФ-В по сравнению с нормальная группа, которая восстановилась после приема ретиноевой кислоты лечение. Активность β-глюкозидазы также восстанавливалась после пероральное введение ФРБ, ФСБ и ФСК (40 мг/кг). FSC-обработка в частности восстановил активность в ~1,3 раза. Поэтому ФРБ, ФСБ и FSC (40 мг/кг) могут предотвращать фотостарение, как видно из Результаты анализа TEWL и β-глюкозидазы.

Воздействие ФРБ, ФСБ и ФСБ на гистологическое изменение

Для оценки положительного эффекта ФРБ, ФСБ и ФСБ (40 мг/кг) на кожные морщины, эпидермальную толщу дорсальной кожу мышей HR-1, облученных УФ-В, измеряли с помощью окрашивания H&E. (Рис. 4А и Б). Эпидермальный наблюдалось увеличение толщины в группе носителя UVB, когда по сравнению с обычной контрольной группой. Однако мыши орально под управлением ФРБ, ФСБ и ФСБ продемонстрировали значительный уменьшаться (Р<0.01) по толщине эпидермиса по сравнению с УФБ группа транспортных средств. Как представлено на рис. 4С, в коллагеновом волокне наблюдались дополнительные изменения. структуры в дорсальной ткани кожи с помощью окрашивания М-Т. Интенсивность Окрашивание М-Т уменьшилось в группе, получавшей носитель UVB, по сравнению с обычная контрольная группа. Этот результат указывает на ускорение в процесс образования морщин вследствие деградации коллагена. Однако количество коллагеновых волокон увеличилось у мышей при пероральном введении. вводимых FRB, FSB и FSC по сравнению с таковыми в УФБ группа транспортных средств.Распределение тучных клеток и степень дегрануляции в дерме и подкожном слое представлены в Рис. 4D. Инфильтрация тучными клетками вокруг дермы значительно увеличилось в группе носителя UVB по сравнению с нормальной контрольной группой, тогда как этот эффект была снижена в тканях мышей, получавших FRB, FSB и FSC (40 мг/кг). Эти результаты показывают, что FRB, FSB и FSC ингибируют Изменения толщины эпидермиса, вызванные УФ-В, деградация коллагена и инфильтрация тучными клетками.

Рисунок 4

Ингибирование УФ-индуцированного гистологическое изменение FRB, FSB и FSC у бесшерстных мышей.Гистологические изменения толщины эпидермиса, коллагена деградацию и инфильтрацию тучных клеток анализировали с использованием (A) окраска гемотоксилином и эозином, (B) толщина эпидермиса дорсальной кожа, (C) трихромное окрашивание по Массону и (D) толуидиновый синий окрашивание соответственно. Все значения представлены как среднее значение ± стандартное отклонение. Непараметрический критерий Крускала-Уоллиса и Апостериорные тесты Бонферрони использовались для контроля множественных сравнения. bP<0,01 по сравнению с нормальными контрольными мышами. ФРБ, ферментированные рисовые отруби; ФСБ, ферментированный соевый жмых; FSC, ферментированный жмых с кунжутом; УФБ, ультрафиолет В; РА, ретиноевая кислота.

Эффекты перорального приема FRB, FSB и FSC на выражение ММП

ММП представляют собой цинкзависимые эндопептидазы, образуется в результате индуцированной УФ-В облучением активации передачи сигналов МАРК факторы транскрипции пути. Функционально MMP классифицируются как стромелизины (включая ММР-3, -10 и -11), желатиназы (ММР-2 и -9) и коллагеназы (ММР-1, -8 и -13) на основе их субстратная специфичность (36). Стромелизины могут расщеплять коллаген типа IV, в дополнение к протеогликаны, ламинин и фибронектин (37).Коллагеназы специфически разрушают коллаген типа I, II и III на характеристики 3/4 и 1/4 фрагменты (38). После при начальном расщеплении тройная спираль коллагена денатурируется, и диссоциированные полипептидные цепи (молекулы желатина) могут затем разрушаться желатиназами (39). Ферменты желатиназы способны расщеплять типы IV, V и VII. коллагена и проявляют активность против денатурированных молекул коллагена (желатин) (40). Чтобы определить влияние FRB, FSB и FSC (40 мг/кг) на экспрессию MMP, HR-1 безволосых мышей облучали УФ-В, чтобы вызвать появление морщин, и экспрессия генов, связанных с морщинами, включая коллагеназы (ММР-13), желатиназы (ММР-2 и -9) и стромелизины (ММР-3), были проанализированы.Как представлено на рис. 5A, уровни экспрессии мРНК MMP-2 и MMP-9 увеличились в UVB. группа носителя по сравнению с нормальной контрольной группой; Однако, Лечение FSB и FSC (только в MMP-9; 40 мг/кг) значительно снизили (P<0,05) уровни экспрессии этих мРНК, когда по сравнению с группой носителя UVB. Нет существенной разницы в Уровни экспрессии мРНК MMP-3 и MMP-13 наблюдались между разные группы; однако средние значения снижались у мышей, принимавших перорально обработанные FRB, FSB и FSC по сравнению с таковыми в UVB группа транспортных средств.Подобно результатам экспрессии мРНК гена MMP-2, Уровни экспрессии белка MMP-2 были значительно подавлены (P<0,05) у мышей, получавших FSB и FSC, по сравнению с UVB группа транспортных средств (рис. 5B). Эти результаты показывают, что FRB, FSB и FSC (40 мг/кг) блокировали коллаген и деградация желатина путем ингибирования активности ММР. Эти результаты было достаточно, чтобы объяснить ингибирование коллагена и желатина деградации, но измерение экспрессии MMP-1 может дать более определенные результаты. Кожа состоит из коллагена II типа. дополнение к типу I и III (41).MMP-13 расщепляет коллаген II типа, а не коллаген I типа. и III (42). Дополнять эти результаты, определение экспрессии MMP-1 и иммуногистохимия для MMPs-индуцированного образования морщин будет выполняться в будущих исследованиях.

Рисунок 5

Влияние FRB, FSB и FSC на MMP и экспрессия цитокинов у безволосых мышей, индуцированных УФ-В. (А) ММП-2, Уровни экспрессии MMP-9, MMP-3 и MMP-13, определенные с помощью RT-qPCR. Суммарную клеточную РНК экстрагировали с помощью РНКазола из тканей кожи.Затем 3 мкг тотальной РНК использовали для синтеза кДНК с помощью RT-qPCR. с соответствующими последовательностями праймеров. (B) Связанный с ферментом иммуносорбентный набор для определения белка MMP-2 выражение. (C) Измерение цитокинов, связанных с воспалением с использованием RT-qPCR. Все значения представлены как среднее ± стандарт. отклонение. Непараметрический критерий Краскела-Уоллиса и критерий Бонферрони. апостериорные тесты использовались для групп MMP-3, MMP-13, TNF-α и IL-1β. однофакторный дисперсионный анализ и апостериорный критерий Шеффе. используется для контроля множественных сравнений.аР<0,05, bP<0,01 и cP<0,001 по сравнению с нормальным контролем мышей. RQ, MMP, матриксная металлопротеиназа; TNF-α, некроз опухоли фактор-α; ЦОГ-2, циклооксигеназа-2; iNOS, индуцируемый оксид азота синтаза; ИЛ, интерлейкин; FRB, ферментированные рисовые отруби; ФСБ, ферментированный соевый жмых; FSC, ферментированный кунжутный жмых; УФБ, ультрафиолет В; РА, ретиноевая кислота; RT-qPCR, количественная обратная транскрипция полимеразной цепной реакции.

Влияние перорального приема FRB, FSB и FSC на экспрессия воспалительных цитокинов

Воспаление кожи, вызванное УФ-В, является основной причиной старение кожи (43).Воздействие кожи к УФ-излучению, как известно, повышает уровень провоспалительные цитокины, включая TNF-α, IL-1β и IL-6 (44). Интересно, что ряд природных было продемонстрировано, что соединения оказывают антифотостарение. путем ингибирования воспалительных цитокинов (45). В настоящем исследовании аналогичное наблюдалось повышение уровня воспалительных цитокинов после УФ-В облучения, которые были снижены после FRB, FSB и FSC лечения (40 мг/кг). Определить влияние ФРБ, ФСБ и ФСБ (40 мг/кг) на уровни воспалительных цитокинов, лысые мыши HR-1 подвергались облучение УФ-В, чтобы вызвать воспаление кожи, после чего связанные с воспалением цитокины, включая TNF-α, COX-2, iNOS, Измеряли IL-6 и IL-1β.Уровень экспрессии мРНК этих наблюдалось увеличение воспалительных цитокинов после УФ-В облучения по сравнению с нормальной группой. Однако также было подтверждено ингибирование экспрессии цитокинов, индуцированной УФ-В. после FRB (TNF-α, COX-2, iNOS, IL-1β, IL-6, все P<0,05), FSB (TNF-α и IL-6, P<0,05; IL-1β, P<0,001) и FSC (TNF-α и iNOS, P<0,05; IL-6 и IL-1β, P<0,001), когда по сравнению с группой носителя UVB (фиг. 5C). Эти наблюдения говорят о том, что FRB, FSB и FSC эффективно ингибируют воспалительную реакцию.

Обсуждение

Биомасса сельскохозяйственных отходов в настоящее время является одним из наиболее важные проблемы, стоящие перед охраной окружающей среды, которые привлек внимание в последние несколько десятилетий (46). Переработка заброшенных сельскохозяйственные отходы имеют значение не только для окружающей среды защиты, но и за его потенциальную ценность в качестве функционального питания ингредиенты. Таким образом, настоящее исследование оценило возможность FRB, FSB и FSC в качестве ингредиентов против фотостарения. Кожа естественным образом состоит из систем антиоксидантной защиты от УФ-индуцированная генерация АФК.Однако эта антиоксидантная защита недостаточно при воздействии солнечного излучения (47). АФК, генерируемые УФБ, могут влиять Передача сигналов MAPK и воспалительные цитокины (23). Активированная передача сигналов MAPK увеличивается активность различных ММР, приводящая к структурным и функциональное нарушение ВКМ (24).

Образование морщин вызвано снижением эластичность кожи и характерно для старения (48). UVB – типичное внешнее старение фактор, который снижает эластичность кожи за счет образования морщин и Известно, что они вызывают острые и хронические реакции на коже человека (49).Воздействие УФ-излучения вызывает раздражение кожи симптомы воспаления кожи, включая эритему, отек, эпидермис утолщение, утолщение кератина и повышенная пигментация кожи (50). Длительное воздействие УФВ также могут вызывать тяжелые поражения кожи, приводящие к гибели клеток и злокачественность (51). Дерма состоит из коллагена, эластина и гиалуроновой кислоты (52). Проявления фотоповрежденной кожи снижение эластичности из-за снижения функции фибробластов (53). Кроме того, фотоповреждение вызывает эластиновые волокна уменьшаются в количестве и диаметре и проявляют морфологические изменения (54).УФ радиация также вызывает дегрануляцию тучных клеток и инфильтрация хроническими воспалительными клетками (55,56). Экспрессия MMP также приводит к образование морщин за счет распада коллагена и эластина, которые являются основными компонентами ECM (57).

Настоящее исследование показало, что ферментированные побочные продукты сельского хозяйства (FRB, FSB и FSC) могут ослабить Индуцированная УФВ продукция воспалительных цитокинов, расщепление коллагена и инфильтрация тучных клеток у бесшерстных мышей. Эти продукты были также продемонстрировано существенное снижение TEWL, вызванного УФ-В, и образование морщин на коже мыши и активация β-глюкозидазы выражение.Кроме того, экспрессия мРНК определенных ММП была оказалось, что он в значительной степени регулируется ферментированным сельскохозяйственным побочные продукты. В заключение результаты настоящего исследования указано, что выброшенные побочные продукты сельского хозяйства могут быть переработаны путем биоконверсии и используются в качестве функциональных материалов в профилактика повреждений кожи, вызванных УФ-В. Однако настоящее исследование не различал эффективность Lentinula edodes (шиитаке) используется для ферментации. Таким образом, будущие исследования должны определить эффект ферментации с Lentinula edodes (шиитаке) и оценить изменения в механизмах биоконверсии, которые связаны с антиоксидантами и против фотостарения.

Сокращения:

ЕСМ

внеклеточный матрикс

ИФА

иммуноферментный анализ

H&E

гематоксилин и эозин

ММП

матриксная металлопротеиназа

УФ

ультрафиолет

ФНО-α

фактор некроза опухоли-α

ЦОГ-2

циклооксигеназа-2

iNOS

индуцибельная синтаза оксида азота

ТЭПВ

трансэпидермальная потеря воды

М-Т

Трихром Массона

Благодарности

Не применимо.

Финансирование

Настоящее исследование было поддержано Корейским Институт планирования и оценки пищевых технологий, Сельское, лесное и рыбное хозяйство, продукты с высокой добавленной стоимостью Программа развития технологий (грант № 314076-3) и исследование грант Канвонского национального университета в 2017 году. Кроме того, настоящее исследование было поддержано Национальным исследовательским фондом Грант Кореи, финансируемый правительством Кореи (грант № NRF-2018 h2A2A1062634; Воспитание ведущих лидеров будущего Фундаментальная наука Программа/Глобальный Ph.D. Программа стипендий).

Наличие данных и материалов

Проанализированные наборы данных, созданные в ходе исследования можно получить у соответствующего автора по разумной цене. запрос.

Вклад авторов

OHL, YCK и SJL разработали текущее исследование. НИЦ, TDJ, BYC, SHC, WSS и XH провели эксперименты. СИЦ и ТДЖ написал рукопись. Все авторы провели анализ данных, и подготовил/критически отредактировал рукопись. Все авторы одобряют версия окончательная версия рукописи и соглашаетесь нести ответственность для всех аспектов исследования.

Одобрение этики и согласие на участвовать

Использование животных в текущем исследовании было одобрено Институциональный комитет по уходу и использованию животных Канвона Национальный университет (разрешение № KW-170417-1 от 15 мая 2017 г.).

Согласие пациента на публикацию

Не применимо.

Конкурирующие интересы

Авторы заявляют, что у них нет конкурирующих интересы, финансовые или иные, связанные с этим публикация.

Каталожные номера

1

Schmalensee R: от «зеленого роста» к разумная политика: обзор.Энергия Экон. 34 (Приложение 1): S2 – S6. 2012. Просмотр статьи : Академия Google

2

Jänicke M: «Зеленый рост»: от растущего экоиндустрии к экономической устойчивости. Энергетическая политика. 48:13–21. 2012. Просмотр статьи : Google Scholar

3

Пешель В., Дикманн В., Зонненшайн М. и Plescher A: Высокий антиоксидантный потенциал отходов прессования вечерняя примула по сравнению с другими масличными жмыхами и растениями антиоксиданты.Индивидуальное растениеводство 25:44–54. 2007. Просмотр статьи: Google Scholar

4

Асадулла М.: Барьеры коммерческой власти генерация с использованием газа газификации биомассы: обзор. Продлить Суст Энергия Откр. 24: 201–215. 2013.

5

Ивата Т: Биоразлагаемый и на биологической основе полимеры: будущие перспективы экологически чистых пластиков. Ангью Чем Инт Эд англ. 54:3210–3215. 2015. Просмотр статьи: Google Scholar: PubMed/NCBI

.

6

Перкинс С., Сиддики С., Пури М. и Демен AL: Биотехнологические применения микробной биоконверсии.крит Преподобный Биотехнолог. 36:1050–1065. 2016. Просмотр статьи : Google Scholar

7

Чо Ю.Х., Чо Дж.С. и Ли Г.В.: Антиоксидант активность древесного уксуса путем биоконверсии. J Korea Acad Industr Кооп соц. 12:4434–4442. 2011. Просмотр статьи : Google Scholar

8

Киран ЭУ, Трзински А.П., Н.Г. В.Дж. и Лю Ю.: Биоконверсия пищевых отходов в энергию: обзор. Топливо. 134: 389–399. 2014.Просмотр статьи : Академия Google

9

Санчес С. и Демен А.Л.: Ферменты и биоконверсии промышленных, фармацевтических и биотехнологических значение. Организационный процесс Res Dev. 15: 224–230. 2011. Просмотр статьи : Google Scholar

10

Jung TD, Shin GH, Kim JM, Choi SI, Lee JH, Lee SJ, Park SJ, Woo KS, Oh SK и Lee OH: сравнительный анализ γ-оризанол, β-глюкан, общее содержание фенолов и антиоксидант активности в ферментированных рисовых отрубях разных сортов.Питательные вещества. 9:E5172017. Просмотр статьи : Академия Google

11

Jung TD, Shin GH, Kim JM, Oh JW, Choi SI, Lee JH, Lee SJ, Heo IY, Park SJ, Kim HT и др.: Оценка метод проверки содержания биоактивных веществ в ферментированных соевых бобах экстракты путем биоконверсии и их антиоксидантной активности. Дж Корейский Soc Food Sci Nutr. 45:680–689. 2016. Просмотр статьи : Google Scholar

12

Jung TD, Choi SI, Choi SH, Cho BY, Sim WS, Han-Xionggao, Lee SJ, Park SJ, Kim DB, Kim YC и др.: Изменения в противоаллергическое действие кунжута путем биоконверсии.Питательные вещества. 10:E2102018. Просмотр статьи : Академия Google : PubMed/NCBI

13

Крук Дж. и Дучник Э.: Окислительный стресс и кожные заболевания: возможная роль физической активности. Азиатский пакет J Рак Пред. 15: 561–568. 2014. Просмотр статьи: Google Scholar: PubMed/NCBI

.

14

Уэбб А.Р. и Энгельсен О.: рассчитано Уровни воздействия ультрафиолета для здорового статуса витамина D. Фотохим Фотобиол.82: 1697–1703. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

.

15

Taylor GJ, Bannister GC и Leeming JP: Дезинфекция ран ультрафиолетовым излучением. Джей Хосп заражает. 30:85–93. 1995. Просмотр статьи: Google Scholar: PubMed/NCBI

.

16

Имокава Г.: Механизм УФ-индуцированного сморщивание кожи: паракринная цитокиновая связь между кератиноцитов и фибробластов, что приводит к стимуляции эластаза.J Investig Dermatol Symp Proc. 14:36–43. 2009. Просмотр статьи: Google Scholar: PubMed/NCBI

.

17

Matts PJ: Солнечное ультрафиолетовое излучение: Определения и терминология. Дерматол клин. 24:1–8. 2006. Просмотр статьи : Академия Google

18

Algaba I и Riva A: измерение in vitro коэффициента ультрафиолетовой защиты швейных тканей. Цвет Технол. 118:52–58. 2002.Просмотр статьи : Академия Google

19

Kim DB, Shin GH, Kim JM, Kim YH, Lee JH, Lee JS, Song HJ, Choe SY, Park IJ, Cho JH и Lee OH: Антиоксидант и омолаживающая активность смеси соков на основе цитрусовых. Еда хим. 194:920–927. 2016. Просмотр статьи : Google Scholar

20

Афак Ф. и Мухтар Х.: Ботанический антиоксиданты в профилактике фотоканцерогенеза и фотостарение.Опыт Дерматол. 15: 678–684. 2006. Просмотр статьи: Google Scholar: PubMed/NCBI

.

21

Юркевич Б.А., Биссет Д.Л. и Бюттнер Г.Р.: Влияние местного применения токоферола на ультрафиолет Радиационно-опосредованное повреждение кожи свободными радикалами. Джей Инвест Дерматол. 104:484–488. 1995. Просмотр статьи: Google Scholar: PubMed/NCBI

.

22

Вейхенталь М., Годорр М., Альтенхофф Дж., Neuber K и Breitbart EW: Влияние УФ-излучения всего тела на продукция цитокинов мононуклеарными клетками периферической крови из больных меланомой I стадии.Арка Дерматол Рез. 292: 348–353. 2000. Просмотр статьи : Академия Google : PubMed/NCBI

23

Muthusamy V и Piva TJ: Реакция на УФ-излучение кожи: обзор сигнала MAPK, NFkappaB и TNFalpha пути трансдукции. Арка Дерматол Рез. 302:5–17. 2010. Просмотр статьи : Академия Google

24

Миячи Ю: Фотостарение из-за окислительного воздействия точка зрения. J Дерматол Sci. 9: 79–86.1995. Просмотр статьи: Google Scholar: PubMed/NCBI

.

25

Choi SH, Choi SI, Jung TD, Cho BY, Lee JH, Kim SH, Yoon SA, Ham YM, Yoon WJ, Cho JH и Lee OH: Экстракты чеджу путгюль (незрелые цитрусовые) противодействуют фотостарению кожи. кожные фибробласты человека и безволосая мышь, индуцированная ультрафиолетом В кожа. Int J Mol Sci. 18:E20522017. Просмотр статьи : Академия Google : PubMed/NCBI

26

Кумар С.: Исследовательский анализ глобальных косметическая промышленность: основные игроки, технологии и тенденции рынка.Техновация. 25:1263–1272. 2005. Просмотр статьи: Google Scholar

27

Ландрискина А., Розен Дж. и Фридман А.: Нанотехнологии, воспаление и кожный барьер: инновации подходы к здоровью кожи и косметике. Косметические средства. 2: 177–186. 2015. Просмотр статьи : Google Scholar

28

Чон С.К., Пак Ч.Х. и Ким Ч.Х.: Тенденция развития продуктов для красоты кожи с эффектом защиты кожи из природного источника.Азиатская косметика J Beauty. 11: 203–212. 2013.

29

Яар М. и Гилкрест Б.А.: Старение против фотостарение: постулированные механизмы и эффекторы. Джей Инвестирование Дерматол Симп Проц. 3:47–51. 1998.

30

Биссет Д.Л., Ханнонанд Д.П. и Орр ТВ: животная модель кожи солнечного старения: гистологические, физические и видимые изменения в коже голых мышей, облученных УФ-излучением. Фотохимия Фотобиол.46:367–378. 1987. Просмотр статьи: Google Scholar: PubMed/NCBI

.

31

Ливак К.Дж. и Шмитген Т.Д.: Анализ данные об относительной экспрессии генов с использованием количественной ПЦР в реальном времени и метод 2(−Delta Delta C(T)). Методы. 25:402–408. 2001. Просмотр статьи : Академия Google

32

Квон С.Б., Ли Г.Т., Чой С.Дж., Ли Н.К., Пак Х.В., Lee KS, Lee KK, Ahn KJ и An IS: Влияние глицерина, гиалуроновая кислота и силиконовое масло на увлажнение, увлажнение и трансэпидермальная потеря воды в коже человека.Азиатская красотка J Косметол. 11: 761–768. 2013.

33

Насир А: Заболевания, связанные с дисфункция кожного барьера: фундаментальные научные аспекты и клинические перспективы. Токсикология кожи. Монтейру-Ривьер, Северная Каролина: Информация Здравоохранение; Нью-Йорк: стр. 203–279. 2010

34

Китатани К., Шелдон К., Раджагопалан В., Анелли В., Дженкинс Р.В., Сан Ю., Грабовски Г.А., Обейд Л.М. и Ханнун Ю.А.: Участие кислой бета-глюкозидазы 1 в пути спасения образование церамидов.Дж. Биол. Хим. 284:12972–12978. 2009. Просмотр статьи: Google Scholar: PubMed/NCBI

.

35

Сирикудта В., Култанан К., Варотай С. и Nuchkull P: Увлажняющие средства для пациентов с атопическим дерматитом: An обзор. J Аллергия Ther. 4:1–6. 2013. Просмотр статьи : Google Scholar

36

Гкуверис И., Никитакис Н., Асирватам Дж., Рао Н и Огбуреке КУЭ: Матриксные металлопротеиназы в голове и шее рак: текущие перспективы.Металлопротеиназы Мед. 4:47–61. 2017. Просмотр статьи : Google Scholar

37

Чин Дж. Р., Мерфи Г. и Верб З.: Стромелизин, металлоэндопептидаза, разлагающая соединительную ткань, секретируемая стимулировали синовиальные фибробласты кролика параллельно с коллаж-нос. Биосинтез, выделение, характеристика и субстраты. Дж. Биол. Хим. 260:12367–12376. 1985. PubMed/NCBI

.

38

Сунами Э., Цуно Н., Осада Т., Сайто С., Китаяма Дж., Томодзава С., Цуруо Т., Сибата Й., Муто Т. и Нагава Х.: ММП-1 является прогностическим маркером гематогенного метастазирования колоректальный рак.Онколог. 5:108–114. 2000. Просмотр статьи: Google Scholar: PubMed/NCBI

.

39

Fini ME и Girard MT: модель Экспрессия металлопротеиназы фибробластами роговицы изменяется пассаж в культуре клеток. Дж. Клеточные науки. 97:373–383. 1990. PubMed/NCBI

.

40

Мерфи Г., Хембри Р. М., МакГаррити А. М., Рейнольдс Дж. Дж. и Хендерсон Б. Желатиназа (коллагеназа IV типа) иммунолокализация в клетках и тканях: использование антисыворотки для желатиназа кроличьей кости, которая идентифицирует формы с высоким и низким Mr.Дж Клеточная наука. 92: 487–495. ПабМед/NCBI

41

Мейгель В.Н., Гей С. и Вебер Л.: Кожный покров структура и распределение типов коллагена. Арка Дерматол Рез. 259:1–10. 1977. Просмотр статьи : Google Scholar : PubMed/NCBI

.

42

Робишо Т.К., Стеффенсен Б. и Филдс Г.Б.: Взаимодействия экзосайтов влияют на матриксную металлопротеиназу коллагена особенности. Дж. Биол. Хим. 286:37535–37542.2011. Просмотр статьи: Google Scholar: PubMed/NCBI

.

43

Пиллаи С., Оресахо С. и Хейворд Дж.: Ультрафиолетовое излучение и старение кожи: роль реактивного кислорода виды, воспаление и активация протеаз, а также стратегии предотвращение вызванной воспалением деградации матрикса — обзор. Интерн. J косметика наук. 27:17–34. 2005. Просмотр статьи: Google Scholar

44

Николс Дж.А. и Катияр СК: Кожа фотозащита натуральными полифенолами: противовоспалительное, антиоксиданты и механизмы репарации ДНК.Арка Дерматол Рез. 302:71–83. 2010. Просмотр статьи : Google Scholar

45

Чен К.С., Чанг А.Н., Лю Х.Н. и Чанг Ю.Т.: EGb-761 предотвращает фотостарение, вызванное ультрафиолетом B, путем инактивации. митоген-активируемых протеинкиназ и провоспалительных цитокинов выражение. J Дерматол Sci. 75:55–62. 2014. Просмотр статьи: Google Scholar: PubMed/NCBI

.

46

Fo KY и Hameed BH: Использование риса зола шелухи как новый адсорбент: разумная переработка коллоидного сельскохозяйственные отходы.Adv Colloid Interfac Sci. 152:39–47. 2009. Просмотр статьи : Академия Google

47

Апулия С, Офферта А, Сайя А, Тромбетта Д и Venera C: защитный эффект экстракта красного апельсина добавки против повреждений кожи, вызванных УФ-излучением: фотостарение и солнечные лентиго. J Космет Дерматол. 13:151–157. 2014. Просмотр статьи: Google Scholar: PubMed/NCBI

48

Davies KJ: Повреждение и деградация белков кислородным радикалом.I. Общие аспекты. Дж. Биол. Хим. 262:9895–9901. 1987. PubMed/NCBI

.

49

Биссет Д.Л., Чаттерджи Р. и Хэннон Д.П.: Фотозащитный эффект антиоксидантов, удаляющих супероксиды против хронических поражений кожи, вызванных ультрафиолетовым излучением, в безволосая мышь. Фотодерматол Фотоиммунол Фотомед. 7: 56–62. 1990. PubMed/NCBI

.

50

Корач Р.Р. и Хамбхоля К.М.: Потенциал травы в защите кожи от ультрафиолета.Фармаког Рев. 5:164–173. 2011. Просмотр статьи : Google Scholar

51

Чхве В.Х., Энн Х.С., Чой Т.И., Джин С.И. и Ан РМ: Влияние натуральных экстрактов на вызванную УФ-В пигментацию и воспаление кожи мышей C57BL/6. Корейский J Environ Health Sci. 32:492–498. 2006.

52

Нанашима Н., Хориэ К., Маэда Х., Томисава Т., Kitajima M и Nakamura T: Антоцианы черной смородины повышают уровни коллагена, эластина и гиалуроновой кислоты в коже человека фибробластов и овариэктомированных крыс.Питательные вещества. 10:E4952018. Просмотр статьи : Академия Google

53

Варани Дж., Шугер Л., Дам М.К., Леонард С., Fligiel SE, Kang S, Fisher GJ и Voorhees JJ: уменьшение количества фибробластов взаимодействие с интактным коллагеном как механизм подавления синтез коллагена в фотоповрежденной коже. J Расследуя дерматол. 122: 1471–1479. 2004. Просмотр статьи: Google Scholar: PubMed/NCBI

.

54

Фрэнсис С. и Роберт Л.: Эластин и Эластические волокна в нормальной и патологической коже.Int J Дерматол. 23:166–179. 1984. Просмотр статьи: Google Scholar: PubMed/NCBI

.

55

Клигман Л.Х. и Клигман А.М. Природа Фотостарение: его профилактика и восстановление. Фотодерматол. 3: 215–227. 1986. PubMed/NCBI

.

56

Foote CS: фотосенсибилизированное окисление и синглетный кислород; последствия в биологических системах. Свободные радикалы в биологии. Прайор, Вашингтон: Академическая пресса; Нью-Йорк: стр.85–133. 1976 г., Просмотр статьи : Академия Google

57

Hwang BM, Noh EM, Kim JS, Kim JM, You YO, Хван Дж. К., Квон К. Б. и Ли Ю. Р.: Куркумин ингибирует матрицу, индуцированную УФ-В излучением. Экспрессия металлопротеиназы-1/3 путем подавления MAPK-p38/JNK путей в дермальных фибробластах человека. Опыт Дерматол. 22:371–374. 2013. Просмотр статьи: Google Scholar: PubMed/NCBI

.

Профилактический эффект диетического астаксантина в отношении фотостарения кожи, вызванного УФА, у бесшерстных мышей

Abstract

Астаксантин, каротиноид, содержащийся в основном в морепродуктах, имеет потенциальное клиническое применение благодаря своей антиоксидантной активности.В этом исследовании мы оценили влияние диетического астаксантина, полученного из Haematococcus pluvialis , на фотостарение кожи у безволосых мышей, облученных УФ-А, путем оценки различных параметров фотостарения. После хронического воздействия ультрафиолета А (УФА) наблюдалось значительное увеличение трансэпидермальной потери воды (ТЭПВ) и образование морщин на спине кожи, вызванное УФА, а диетический астаксантин значительно подавлял эти признаки фотостарения. Мы обнаружили, что экспрессия мРНК лимфоэпителиального ингибитора типа Kazal, стероидсульфатазы и аквапорина 3 в эпидермисе значительно увеличивалась при облучении УФ-А в течение 70 дней, а диетический астаксантин значительно подавлял это увеличение экспрессии мРНК, чтобы быть сравнимым с уровни контроля.В дерме экспрессия мРНК матриксной металлопротеазы 13 увеличивалась при облучении УФ-А и значительно подавлялась диетическим астаксантином. Кроме того, анализ ВЭЖХ-ФДА подтвердил, что пищевой астаксантин достигал не только дермы, но и эпидермиса. Наши результаты показывают, что диетический астаксантин накапливается в коже и, по-видимому, предотвращает влияние УФА-излучения на метаболизм филаггрина и шелушение в эпидермисе и внеклеточном матриксе в дерме.

Образец цитирования: Komatsu T, Sasaki S, Manabe Y, Hirata T, Sugawara T (2017) Профилактическое действие диетического астаксантина на фотостарение кожи, вызванное УФ-А, у голых мышей.ПЛОС ОДИН 12(2): e0171178. https://doi.org/10.1371/journal.pone.0171178

Редактор: Анджей Т. Сломински, Университет Алабамы в Бирмингеме, США

Поступила в редакцию: 14 декабря 2016 г.; Принято: 17 января 2017 г .; Опубликовано: 7 февраля 2017 г.

Авторское право: © 2017 Komatsu et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Все соответствующие данные содержатся в документе и в его файлах вспомогательной информации.

Финансирование: Корпорация FUJIFILM профинансировала это исследование и оказала поддержку автору TS. Спонсор не участвовал в разработке дизайна исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи. Другие авторы не получали специального финансирования для этой работы.

Конкурирующие интересы: Корпорация FUJIFILM финансировала это исследование и оказывала поддержку автору TS.Другие авторы заявляют об отсутствии конфликта интересов. Это не меняет нашей приверженности политике PLOS ONE в отношении обмена данными и материалами.

Введение

Кожа функционирует как внешний барьер тела и находится в непосредственном контакте с окружающей средой, что вызывает физические повреждения. Кожа может регулировать локальный и глобальный гомеостаз, воспринимая окружающую среду [1, 2]. Однако хроническое воздействие ультрафиолетового (УФ) излучения солнца способствует фотостарению кожи, которое клинически характеризуется сухостью, пигментацией, дряблостью и глубокими морщинами [3, 4].УФ-излучение включает длины волн от 200 до 400 нм и делится на три части: УФА (320–400 нм), УФВ (280–320 нм) и УФС (200–280 нм). Хотя УФ-С отфильтровывается атмосферным озоном по большей части, как УФ-А, так и УФ-В-излучение могут достигать поверхности Земли и вызывать биологические последствия для кожи [5, 6]. УФ-В излучение критически повреждает клеточные макромолекулы и вызывает образование активных форм кислорода. Воздействие УФ-В излучения является основной причиной рака кожи у людей и животных [7].Несмотря на слабую канцерогенность по сравнению с УФВ, УФА излучение составляет до 95% от общего УФ облучения и играет существенную роль в фотостарении кожи человека [8]. UVA способен проникать в дерму, что приводит к повреждению дермального коллагена и эластина, в то время как UVB в основном воздействует на эпидермис и вызывает повреждение ДНК [9]. Следовательно, пищевые добавки с молекулами, которые могут эффективно накапливаться в дерме, могут защитить кожу от повреждений, вызванных УФ-А, таких как фотостарение.

Астаксантин, 3,3′-дигидрокси-β-каротин-4,4′-дион, представляет собой каротиноид, содержащийся в основном в морепродуктах, таких как лосось, форель, омары, креветки и рыбья икра [10, 11].Хорошо известно, что астаксантин имеет потенциальное клиническое применение благодаря своей антиоксидантной активности, которая выше, чем у α-токоферола и других каротиноидов, включая β-каротин [12, 13]. Кроме того, в отличие от других антиоксидантов, астаксантин оказывает антиоксидантное действие, но не является прооксидантным [14]. Астаксантин обладает многими сильнодействующими фармакологическими эффектами, включая противоопухолевую, противораковую, антидиабетическую, антиатеросклеротическую и противовоспалительную активность [15–17]. Кроме того, также сообщалось, что лечение астаксантином предотвращает индуцированный УФ-излучением фотокератит у мышей за счет снижения окислительного стресса в облученных глазах [18] и что атопический дерматит улучшается при пероральном введении астаксантина посредством регуляции воспалительных эффектов и экспрессия воспалительных цитокинов в мышиной модели [19].В культивируемых фибробластах кожи человека астаксантин предотвращал вызванное УФА повреждение ДНК [20]. Следовательно, ожидается, что диетический астаксантин будет способствовать предотвращению фотостарения кожи, если он может накапливаться в дерме. Однако нет информации о влиянии диетического астаксантина на фотостарение кожи in vivo .

В этом исследовании мы оценили влияние диетического астаксантина, полученного из Haematococcus pluvialis , на фотостарение кожи у безволосых мышей, облученных УФ-А, путем определения различных параметров фотостарения. Н . pluvialis представляет собой зеленую микроводоросль, которая накапливает высокие концентрации астаксантина при различных стрессовых условиях и является основным источником астаксантина, используемого в пищевой промышленности и аквакультуре [21, 22]. Наши результаты показывают, что диетический астаксантин эффективно предотвращает фотостарение кожи, вызванное воздействием УФ-А у мышей.

Материалы и методы

Материалы

Моноэфир астаксантина очищали из имеющегося в продаже масла, экстрагированного из H . pluvialis (ASTOTS-S, FUJIFUILM Co., Токио, Япония) на колонке с силикагелем [23]. Вкратце, масло растворяли в смеси гексан/хлороформ (5/1, об./об.) и загружали в хроматографическую колонку (50×300 мм), заполненную 160 г силикагеля в гексане. Колонку промывали гексаном и смесью ацетон/гексан (1/10, об./об.). Фракцию моноэфира астаксантина, элюированную ацетоном/гексаном (1/5), собирали, а затем наносили на силикагель, проявляя ТСХ в смеси хлороформ/метанол/вода (64/16/2, об./об./об.) для проверки чистоты.

Животные

самки безволосых мышей Hos:HR-1 (возраст 6 недель) были приобретены у Hoshino Laboratory Animals (Ибараги, Япония). Их содержали при температуре 24 ± 1°C с 12-часовым циклом свет:темнота. Во время экспериментов их кормили стандартным кормом (Восточные дрожжи, Токио, Япония) и водой в свободном доступе. Экспериментальный протокол этого исследования был одобрен Комитетом животных Киотского университета. После акклиматизации мышей разделили на четыре группы (n = 5). Мышей опытных групп кормили рационом АИН-93Г с 0.01% или 0,1% моноэфир астаксантина, очищенный от H . pluvialis (группы 0,01%Ax и 0,1%Ax) (табл. 1). Мышей в нормальной и контрольной группах кормили только AIN-93G.

Эксперимент на животных

Источник УФ-излучения представлял собой группу из двух УФ-ламп BLB (15 Вт, максимальная интенсивность излучения при 365 нм, УФП, Калифорния, США). Расстояние от ламп до мышей было примерно 18 см, а воздух циркулировали вентиляторы. Облучение проводили в кондиционируемом помещении, температуру в клетке поддерживали на уровне 23–26°С.Мышей опытных групп подвергали воздействию дозы 20 Дж/см 2 пять раз в неделю в течение 70 дней [24]. УФ-силу измеряли при 365 нм с помощью УФ-радиометра VLX-3W (Cosmo Bio, Токио, Япония). В нормальной группе облучение не проводилось. По истечении 70 дней мышей умерщвляли под изофлюрановой анестезией. Немедленно были взяты образцы крови и кожи спины. Кусочки кожи спины фиксировали в 10% нейтральном забуференном растворе формалина для морфологического анализа, срезы кожи спины окрашивали гематоксилином и эозином.Для анализа экспрессии мРНК образцы кожи хранили в RNAlater (Qiagen, Валенсия, Калифорния) при температуре -80°C до использования.

Оценка образования морщин на коже спины

Кожа спины, собранная на 28, 56 и 70 день, была воспроизведена с использованием силиконового продукта (Asahi Biomed, Йокогама, Япония) под анестезией изофлураном [25]. Изображения реплики кожи анализировали с использованием программного обеспечения для анализа морщин кожи (Asahi Biomed). Параметрами для оценки кожных морщин были соотношение общего объема бороздок, соотношение площади морщин, соотношение объема морщин и количество морщин.

ВЭЖХ анализ концентрации астаксантина в коже и плазме

Чтобы отделить эпидермис кожи от дермы, кожу спины мыши, собранную с помощью одноразовых биопсийных инструментов (Kai Industries Co., Ltd., Гифу, Япония), реагировали с 2,5 ед./мл Dispase ® II (нейтральная протеаза, класс II, Roche, Индианаполис, Индиана) в сбалансированном солевом растворе Хэнкса+ (HBSS(+), Nacalai Tesque, Inc., Киото, Япония) в течение ночи при 4°C [26]. После инкубации эпидермис отделяли от дермы по базальной мембране.Общие липиды экстрагировали из каждого образца эпидермиса и дермы, а также из образцов плазмы с использованием хлороформа и метанола [27]. После упаривания собранной хлороформной фазы остаток растворяли в аликвоте метанола и затем подвергали ВЭЖХ-анализу для количественного определения астаксантина [23].

Количественное определение НМФ с помощью ВЭЖХ

Для определения содержания НМФ в эпидермисе анализировали РСА и УКА методом ВЭЖХ. Эпидермис мыши (0,5 см 2 ), приготовленный, как описано выше, гомогенизировали со 100 мкл физиологического раствора и затем добавляли к 300 мкл этанола.После энергичного перемешивания в течение 1 мин и центрифугирования (1700×g) в течение 15 мин при 4°С надосадочную жидкость собирали и затем выпаривали азотом. Образец растворяли в дистиллированной воде и аликвоту подвергали ВЭЖХ, оснащенной матричным фотодиодным детектором с колонкой COSMOSIL 5C18AR (3,0×150 мм, 5 мкм, Nacalai Tesque). Подвижную фазу доводили водой до рН 2,6 с помощью фосфорной кислоты при скорости потока 0,4 мл/мин. PCA и UCA были обнаружены при 210 и 270 нм соответственно и количественно оценены по площади их пика с использованием стандартной кривой с аутентичными стандартами.

Получение РНК и qRT-PCR в реальном времени

Образцы кожи в RNAlater промывали HBSS (+) и затем разделяли на эпидермис и дерму, как описано выше. Тотальную РНК выделяли из эпидермиса и дермы с помощью реагента Sepasol (Nacalai Tesque) в соответствии с инструкциями производителя и обрабатывали ДНКазой (Wako Pure Chemical Industries). кДНК синтезировали с использованием обратной транскриптазы SuperScript RNase II (Invitrogen, Carlsbad, CA) со случайными гексамерами. Для ОТ-ПЦР кДНК разводили и смешивали с супермиксом iQ SYBR Green (Bio-Rad Laboratories), содержащим 1 ммоль/л праймера для ПЦР (последовательности праймеров показаны в таблице S1).qRT-PCR в реальном времени проводили с использованием системы DNA Engine Option (Bio-Rad Laboratories). Условия термоциклирования: 15 мин при 95°С в течение 1 цикла, затем амплификация в течение 43 циклов с плавлением в течение 15 с при 95°С и отжигом и удлинением в течение 30 с при 60°С. Уровень экспрессии каждого гена нормализовали, используя GAPDH в качестве внутреннего контроля.

Статистический анализ

Данные представлены как среднее значение ± стандартное отклонение. Статистический анализ проводили с помощью однофакторного дисперсионного анализа с последующим тестом Шеффе.Различия считались значимыми при значениях P < 0,05.

Результаты

Влияние пищевого астаксантина на свойства кожи и других тканей

Ежедневное потребление пищи и прибавка массы тела существенно не различались между четырьмя группами в течение экспериментального периода (таблица 2). После лечения в течение 70 дней масса ткани, исключая брыжеечную белую жировую ткань, существенно не различалась между группами. Масса брыжеечной жировой ткани в 0.Группа 01%Ax была значительно ниже, чем в контрольной группе. Не было различий в параметрах плазмы между группами (таблица 3).

Для оценки барьерной функции эпидермальной проницаемости периодически контролировали трансэпидермальную потерю воды (TEWL) в течение периода УФА-облучения (рис. 1). После хронического воздействия УФА наблюдалось значительное увеличение TEWL под действием УФА, что продемонстрировало тенденцию к подавлению диетическим астаксантином через 56 дней. Через 70 дней TEWL как в 0.В группах с добавлением 01% и 0,1% астаксантина было значительно ниже, чем в контрольной группе, облученной УФ-А, но эффект не зависел от дозы.

Рис. 1. Влияние диетического астаксантина на уровни TEWL у бесшерстных мышей.

Данные представляют собой среднее ± стандартное отклонение (n = 5). Столбцы с совпадающими буквами в каждый момент времени значительно отличаются друг от друга при P <0,05.

https://doi.org/10.1371/journal.pone.0171178.g001

Для сравнения уровня образования морщин образцы кожи были собраны через 28, 56 и 70 дней.На рис. 2 показаны увеличенные изображения реплик кожи репрезентативных мышей в каждой группе через 70 дней. В контрольной группе образовались глубокие грубые морщины. Для количественной оценки степени образования морщин реплики кожи были проанализированы с использованием системы анализа трехмерных изображений (рис. 3). Коэффициент общего объема бороздок, коэффициент площади морщин, коэффициент объема морщин и количество морщин были значительно увеличены в контрольной группе по сравнению с нормальной группой, а диетический астаксантин значительно подавлял или имел тенденцию к подавлению увеличения этих параметров при облучении УФ-А в 56 лет. дней.Эти параметры были значительно ниже во всех группах, получавших астаксантин, чем в контрольной группе через 70 дней.

Рис. 3. Влияние диетического астаксантина на образование морщин, вызванное УФА, у бесшерстных мышей.

Данные представляют собой среднее ± стандартное отклонение (n = 5). Столбцы с совпадающими буквами в каждый момент времени значительно отличаются друг от друга при P <0,05.

https://doi.org/10.1371/journal.pone.0171178.g003

На рис. 4 показаны срезы кожи спины, окрашенные H&E.Толщина эпидермиса обычно используется в качестве параметра, отражающего фотостарение кожи. В этом исследовании диетический астасантин не влиял на увеличение толщины эпидермиса, вызванное УФ-излучением.

Накопление пищевого астаксантина в плазме и коже

Астаксантин был обнаружен в плазме с помощью анализа ВЭЖХ после приема пищевых добавок в течение 70 дней. Концентрация астаксантина в плазме в группе 0,1% астаксантина была значительно выше, чем в группе 0.01% группа астаксантина. Мы подтвердили, что диетический астаксантин также способен достигать кожи. Как показано на рис. 5, астаксантин дозозависимо накапливался в коже мышей, подобно картине, наблюдаемой в плазме. Кроме того, мы обнаружили, что концентрация астаксантина в дерме была примерно в 20–30 раз выше, чем в эпидермисе на квадратный миллиметр площади кожи.

Рис. 5. Концентрация астаксантина в плазме и коже (эпидермисе и дерме) бесшерстных мышей.

Данные представляют собой среднее значение ± стандартное отклонение (n = 5). Столбцы с совпадающими буквами значительно отличаются друг от друга при P <0,05.

https://doi.org/10.1371/journal.pone.0171178.g005

Влияние астаксантина на экспрессию мРНК в коже

Влияние астаксантина на экспрессию генов, связанных с барьерной функцией в эпидермисе, анализировали с помощью ОТ-ПЦР в реальном времени. Мы обнаружили, что уровни экспрессии мРНК лимфоэпителиального ингибитора типа Kazal (LEKTI), стероидной сульфатазы (STS) и аквапорина 3 (AOP3) значительно повышались при облучении УФ-А в течение 70 дней.Диетический астаксантин значительно подавлял это увеличение экспрессии мРНК до контрольных уровней (рис. 6). Ингибитор сериновых протеаз LEKTI, который кодируется SPINK5 , экспрессируется в наиболее дифференцированных жизнеспособных слоях многослойной эпителиальной ткани и ингибирует сериновые протеазы, включающие пептидазы, связанные с калликреином человека (KLK), включая KLK5, KLK5 и KLK14 [28]. . Эти сериновые протеазы являются ключевыми протеазами, участвующими в десквамации, и способствуют выработке естественных увлажняющих факторов (NMF) из профилаггрина [29].Таким образом, мы измерили содержание пироглутаминовой кислоты (PCA) и урокановой кислоты (UCA), которые являются основными NMF в эпидермисе, с помощью анализа ВЭЖХ. Воздействие УФ-А значительно снизило содержание РСА в эпидермисе, а содержание в группах 0,01% и 0,1% астаксантина продемонстрировало тенденцию к улучшению (рис. 7а). Напротив, содержание УКА в группе с 0,01% астаксантина было значительно выше, чем в контрольной группе, в то время как содержание УКА в группах с нормальным и 0,1% астаксантином существенно не отличалось от такового ни в контроле, ни в 0.01% группы астаксантина (фиг. 7b).

Рис. 6. Влияние диетического астаксантина на экспрессию мРНК в эпидермисе голых мышей, облученных УФ-А.

Данные представляют собой среднее значение ± стандартное отклонение (n = 5). Столбцы с совпадающими буквами значительно отличаются друг от друга при P <0,05.

https://doi.org/10.1371/journal.pone.0171178.g006

Рис. 7. Влияние пищевого астаксантина на содержание NMF в эпидермисе голых мышей, облученных УФА.

Данные представляют собой среднее значение ± стандартное отклонение (n = 5).Столбцы с совпадающими буквами значительно отличаются друг от друга при P <0,05.

https://doi.org/10.1371/journal.pone.0171178.g007

В дерме экспрессия мРНК матриксной металлопротеазы 13 (ММР13) увеличивалась под действием УФА-облучения, и это увеличение было значительно подавлено в 0,1% астаксантина. группа (рис. 8а). Паттерн экспрессии мРНК проопиомеланокортина (POMC) был аналогичен таковому для MMP13, но эффект астаксантина не был значительным (рис. 8b).С другой стороны, диетический астаксантин имеет тенденцию подавлять снижение экспрессии мРНК трансглутаминазы 2 (TGM2) под действием УФА-излучения (рис. 8с).

Рис. 8. Влияние диетического астаксантина на экспрессию мРНК в дерме голых мышей, облученных УФ-А.

Данные представляют собой среднее ± стандартное отклонение (n = 5). Столбцы с совпадающими буквами значительно отличаются друг от друга при P <0,05.

https://doi.org/10.1371/journal.pone.0171178.g008

Обсуждение

Разнообразное УФ-излучение играет важную роль в состоянии кожи и регулирует гомеостаз организма как на локальном [30–32], так и на системном уровнях [33–35].Насколько нам известно, это одно из первых исследований in vivo, оценивающих защитный эффект диетического астаксантина против фотостарения кожи, вызванного УФА-излучением. Внутреннее и хронологическое старение кожи характеризуется атрофией кожи с потерей эластичности и замедлением метаболической активности. Количественно отличное от естественного старения фотостарение кожи, которое клинически характеризуется сухостью, пигментацией, дряблостью и глубокими морщинами, возникает в результате накопления повреждений окружающей среды, в частности воздействия ультрафиолетового излучения [3, 4].Было высказано предположение, что воздействие УФ-А способствует фотоповреждению кожи человека, поскольку на УФ-А приходится примерно 95% индивидуального воздействия солнечной радиации [8]. В этом исследовании мы обнаружили, что пищевые добавки с астаксантином эффективно предотвращали признаки фотостарения, такие как увеличение TEWL и образование морщин, в спинной коже мышей, подвергшихся воздействию УФА-излучения. Расчетное потребление астаксантина в условиях данного исследования, исходя из массы тела, составляло 20–200 мг в день для человека.Однако кажется, что более низкой дозы достаточно, чтобы быть эффективной для человека, потому что поглощение каротиноидов у мышей обычно меньше, чем у человека [36]. Сообщалось, что концентрация астаксантина в плазме у человека после приема астаксантина в дозе 3 мг/день в течение 12 недель составила 62±25 пмоль/мл, что аналогично уровню астаксантина в плазме у группы, получавшей 0,01% Ax в этом исследовании (92± 48 пмоль/мл) [37].

Высокодифференцированные уплощенные кератиноциты, называемые корнеоцитами, являются строительными блоками эпидермального барьера.NMF, образующиеся при протеолизе филаггрина, необходимы для удержания воды внутри корнеоцитов и приводят к их оптимальной гидратации и набуханию [38]. Профилагрин, предшественник филаггрина, подвергается протеолизу с помощью KLK5 с образованием мономеров филаггрина [39], а филаггрин расщепляется на небольшие пептиды, а затем на свободные аминокислоты посредством многостадийных процессов с участием каспазы-14 [40, 41]. KLK7 расщепляет прокаспазу-14 с образованием вторичной формы, которая впоследствии опосредует обычную активацию прокаспазы-14 [42].LEKTI является мощным ингибитором не только KLK5, KLK7 и KLK14, но и каспазы-14 [43]. Напротив, баланс между активностью протеаз, таких как KLK7, и ингибиторов протеаз, таких как LEKTI, определяет скорость десквамации (осыпание корнеоцитов) [28]. Следовательно, эпидермальные признаки фотостарения могут быть частично вызваны УФ-индуцированной экспрессией LEKTI. Наши результаты показали, что диетический астаксантин эффективно подавлял индукцию LEKTI при хроническом облучении УФ-А. Кроме того, несмотря на индивидуальные различия, снижение содержания NMF в эпидермисе под воздействием УФ-А, по-видимому, предотвращалось диетическим астаксантином.

В нормальном эпидермисе сульфат холестерина вырабатывается холестеринсульфотрансферазой, но десульфатируется во внешнем эпидермисе с помощью STS, образуя «цикл сульфата холестерина», который мощно регулирует эпидермальную дифференцировку, барьерную функцию и десквамацию [44]. Было высказано предположение, что холестерин сначала сульфатируется в нижних слоях эпидермиса, а затем десульфатируется обратно в холестерин в наружных слоях эпидермиса [45]. может способствовать улучшению этого нарушения.

AQP3, который представляет собой канал, транспортирующий воду/глицерин, экспрессируется в кератиноцитах эпидермиса [46]. Было высказано предположение, что активация AQP3 участвует в пролиферации кератиноцитов, эпидермальной гиперплазии и нарушении барьера при кожных заболеваниях [47]. Фактически сильная экспрессия AQP3 была обнаружена как в базальном слое, так и в шиповатом слое при острой и хронической атопической экземе, хотя эпидермальный AQP3 экспрессировался слабо и в основном обнаруживался в базальном слое в случае нормального состояния [48].Повышенная экспрессия и измененное клеточное распределение AQP3, обнаруживаемое при экземе, может способствовать потере воды. Следовательно, наблюдаемое в этом исследовании увеличение экспрессии мРНК AQP3 в эпидермисе лысых мышей под действием УФА-излучения может быть связано с нарушением кожного барьера, вызванным фотостарением.

УФ-излучение индуцирует матриксную металлопротеазу 1 (ММР1), что приводит к повреждению коллагена, что является одним из признаков фотостарения [49]. Однако у грызунов отсутствует ген ММР-1, который, по-видимому, функционально заменен на ММР13 [50].Профилактический эффект диетического астаксантина на образование морщин может быть связан с подавлением индукции ММР под действием УФА-излучения. Наши результаты согласуются с предыдущим отчетом о том, что облучение УФ-А увеличивает экспрессию POMC в кератиноцитах человека [51] и снижает экспрессию TGM2 в фибробластах кожи человека [52]. В этом исследовании диетический астаксантин имел тенденцию подавлять как увеличение PMOC, так и снижение TGM2 при облучении UVA. Меланоцитостимулирующие гормоны (α-, β- и γ-MSH), которые процессируются отдельными членами семейства прогормонконвертаз, происходят из POMC [53, 54].α-МСГ подавляет экспрессию коллагена в дермальных фибробластах человека [55]. TGM2, идентифицированный как стабильный партнер взаимодействия коллагена VII, является важным ферментом для перекрестного связывания белков. Снижение активности TGM2 объясняет снижение адгезии, уменьшение перекрестного связывания внеклеточного матрикса и снижение целостности эпидермиса и дермы [56].

Большинство ксантофиллов из пищевых источников, включая астаксантин, присутствуют в этерифицированной форме. Есть много сообщений, предполагающих, что эфиры жирных кислот ксантофиллов могут гидролизоваться в пищеварительном тракте, поскольку после перорального приема в крови не обнаружено эфирной формы ксантофилла [57, 58].В соответствии с этими предыдущими выводами, только свободная форма астаксантина была обнаружена в плазме и коже после приема моноэтерифицированного астаксантина в течение 70 дней в этом исследовании. Петри и Лундебай сообщили, что накопление диетического астаксантина в безволосой коже хвоста было намного выше, чем в других тканях. А изменения цвета кожи хвоста по измерениям отражательной способности с помощью портативного спектрофотометра сильно коррелировали с концентрацией диетического астаксантина [59].В настоящем исследовании мы подтвердили, что диетический астаксантин достигает не только дермы, но и эпидермиса с помощью анализа ВЭЖХ-ФДА. Наши данные подтверждают гипотезу о том, что накопления пищевого астаксантина в коже может быть достаточно, чтобы играть профилактическую роль против УФ-повреждений.

В совокупности наше исследование указывает на защитное действие астаксантина в рационе против признаков фотостарения, вызванного УФ-излучением, таких как нарушение барьерной функции и образование морщин на коже.Мы обнаружили, что диетический астаксантин накапливается в коже и может предотвращать воздействие УФА-излучения на метаболизм филаггрина и шелушение эпидермиса и матрикса дермы. Наши результаты подчеркивают потенциал дальнейшего развития астаксантина в качестве нутрицевтика против фотостарения.

Авторские вклады

  1. Концептуализация: TS TH.
  2. Формальный анализ: ТК СС ТС.
  3. Финансирование приобретения: ТС.
  4. Расследование: ТК С.С. Ю.М.
  5. Администрация проекта: ТД ТС.
  6. Письмо – первоначальный проект: TS.
  7. Письмо – обзор и редактирование: ТК СС ЮМ TH ТС.

Каталожные номера

  1. 1. Сломински А.Т., Змиевски М.А., Скобовят С., Збитек Б., Сломински Р.М., Стекети Д.Д. Чувство окружающей среды: регуляция локального и глобального гомеостаза нейроэндокринной системой кожи.Adv Anat Embryol Cell Biol. 2012 г.; 212: 1–115.
  2. 2. Сломински А.Т., Манна PR, Таки RC. О роли кожи в регуляции местной и системной стероидогенной активности. Стероиды. 2015 г.; 103: 72–88. пмид:25988614
  3. 3. Гилхрест Б.А., Яар М. Старение и фотостарение кожи: наблюдения на клеточном и молекулярном уровне. Бр Дж Дерматол. 1992 год; 127: 25–30. пмид:13
  4. 4. Гилкрест Б.А. Обзор старения кожи и его медикаментозной терапии.Бр Дж Дерматол. 1996 год; 135: 867–875. пмид:8977705
  5. 5. Мацумура Ю., Анантасвами Х.Н. Токсическое воздействие ультрафиолетового излучения на кожу. Toxicol Appl Pharmacol. 2004 г.; 195: 298–308. пмид:15020192
  6. 6. Натараджан В.Т., Ганджу П., Рамкумар А., Гровер Р., Гокхале Р.С. Многогранные пути защищают кожу человека от УФ-излучения. Nat Chem Biol. 2014; 10: 542–551. пмид:24937072
  7. 7. Урбах Ф. Ультрафиолетовое излучение и рак кожи человека.J Photochem Photobiol B. 1997; 40: 3–7. пмид:9301039
  8. 8. Паризи А.В., Вонг JCF. Оценка биологической опасности из-за солнечной радиации. J Photochem Photobiol B. 2000; 54: 126–130. пмид:10836542
  9. 9. Тиррелл РМ. Активация экспрессии генов млекопитающих УФ-компонентом солнечного света — от моделей к реальности. Биоэссе. 1996 год; 18: 139–148. пмид:8851047
  10. 10. Хусейн Г., Санкава У., Гото Х., Мацумото К., Ватанабэ Х. Астаксантин, каротиноид с потенциалом для здоровья и питания человека.J Nat Prod. 2006 г.; 69: 443–449. пмид:16562856
  11. 11. Амбати Р.Р., Пханг С.М., Рави С., Асватханараяна Р.Г. Астаксантин: источники, экстракция, стабильность, биологическая активность и его коммерческое применение — обзор. Мар Наркотики. 2014; 12: 128–152. пмид:24402174
  12. 12. Jyonouchi H, Sun S, Tomita Y, Gross MD. Астаксантин, каротиноид без активности витамина А, усиливает реакцию антител в культурах, включая клоны Т-хелперов и субоптимальные дозы антигена.Дж Нутр. 1995 год; 125: 2483–2492. пмид:7562082
  13. 13. Кобаяши М. Антиоксидантная роль астаксантина in vivo при окислительном стрессе у зеленых водорослей Haematococcus pluvialis . Приложение Microbiol Biotechnol. 2000 г.; 54: 550–555. пмид:110
  14. 14. Мартин Х.Д., Рак С., Шмидт М., Селл С., Бейтнер С., Майер Б. и др. Химия окисления каротиноидов и свободнорадикальные реакции. Pure Appl Chem. 1999 г.; 71: 2253–2262.
  15. 15. Chew BP, Park JS, Wong MW, Wong TS.Сравнение противораковой активности диетического бета-каротина, кантаксантина и астаксантина у мышей in vivo. Противораковый Рез. 1999 г.; 19: 1849–1853. пмид:10470126
  16. 16. Пашков Ф.Дж., Ватумулл Д.Г., Кэмпбелл К.Л. Астаксантин: новое потенциальное средство для лечения окислительного стресса и воспаления при сердечно-сосудистых заболеваниях. Ам Джей Кардиол. 2008 г.; 101: 58Д–68Д. пмид:18474276
  17. 17. Kishimoto Y, Yoshida H, Kondo K. Потенциальные антиатеросклеротические свойства астаксантина.Мар Наркотики. 2016; 14: 35.
  18. 18. Ленников А., Китайчи Н., Фукасе Р., Мурата М., Нода К., Андо Р. и соавт. Улучшение фотокератита, вызванного ультрафиолетом, у мышей, получавших глазные капли с астаксантином. Мол Вис. 2012 г.; 18: 455–464. пмид:22393271
  19. 19. Yoshihisa Y, Andoh T, Matsunaga K, Rehman MU, Maoka T, Shimizu T. Эффективность астаксантина для лечения атопического дерматита на мышиной модели. ПЛОС Один. 2016; 11: e0152288. пмид:27023003
  20. 20. Лайонс Н.М., О’Брайен Н.М.Модулирующее действие экстракта водорослей, содержащего астаксантин, на облученные УФ-А клетки в культуре. J Дерматол Sci. 2002 г.; 30: 73–84. пмид:12354422
  21. 21. Кидд П. Астаксантин, питательное вещество для клеточных мембран с разнообразными клиническими преимуществами и потенциалом против старения. Альтерн Мед Рев. 2011; 16: 355–364. пмид:22214255
  22. 22. Guerin M, Huntley ME, Olaizola M. Haematococcus астаксантин: применение для здоровья и питания человека. Тенденции биотехнологии. 2003 г.; 21: 210–216.пмид:12727382
  23. 23. Sugawara T, Kushiro M, Zhang H, Nara E, Ono H, Nagao A. Лизофосфатидилхолин усиливает поглощение каротиноидов из смешанных мицелл клетками кишечника человека caco-2. Дж Нутр. 2001 г.; 131: 2921–2927. пмид:11694619
  24. 24. Шимада Э., Аида К., Сугавара Т., Хирата Т. Ингибирующее действие местного глюкозилцерамида кукурузы на фотостарение кожи у безволосых мышей, облученных УФ-А. J Oleo Sci. 2011 г.; 60: 321–325. пмид:21606620
  25. 25. Урикура И, Сугавара Т, Хирата Т.Защитный эффект фукоксантина против фотостарения кожи, вызванного УФ-В, у бесшерстных мышей. Биоски Биотехнолог Биохим. 2011; 75: 757–760. пмид:21512228
  26. 26. Трост А., Бауэр Дж.В., Ланшютцер С., Лаймер М., Эмбергер М., Хинтнер Х. и др. Быстрое, качественное и специфичное для эпидермиса выделение РНК из кожи человека. Опыт Дерматол. 2007 г.; 16: 185–190. пмид:17286810
  27. 27. Блай Э.Г., Дайер В.Дж. Быстрый метод экстракции и очистки общих липидов. Может J Biochem Physiol.1959 год; 37: 911–917. пмид:13671378
  28. 28. Cork MJ, Danby SG, Vasilopoulos Y, Hadgraft J, Lane ME, Moustafa M, et al. Дисфункция эпидермального барьера при атопическом дерматите. Джей Инвест Дерматол. 2009 г.; 129: 1892–1908. пмид:19494826
  29. 29. де Веер С.Дж., Фурио Л., Харрис Дж.М., Овнанян А. Протеазы: общие виновники кожных заболеваний человека. Тренды Мол Мед. 2014; 20: 166–178. пмид:24380647
  30. 30. Скобовиат С, Дауди Дж.С., Сэйр Р.М., Таки Р.С., Сломински А.Кожный гомолог гипоталамо-гипофизарно-надпочечниковой оси: регулирование ультрафиолетовым излучением. Am J Physiol Endocrinol Metab. 2011 г.; 301: Е484–Е493. пмид:21673307
  31. 31. Скобовиат С., Сейр Р.М., Дауди Дж.С., Сломински А.Т. Ультрафиолетовое излучение регулирует активность кортизола в зависимости от диапазона волн в коже человека ex vivo. Бр Дж Дерматол. 2013; 168: 595–601. пмид:23363016
  32. 32. Сломинский АТ. Ультрафиолетовое излучение (УФО) активирует центральную нервно-эндокринно-иммунную систему.Фотодерматол Фотоиммунол Фотомед. 2015 г.; 31: 121–123. пмид:25660238
  33. 33. Скобовиат С, Сломински А.Т. UVB активирует гипоталамо-гипофизарно-надпочечниковую ось у мышей C57BL/6. Джей Инвест Дерматол. 2015 г.; 135: 1638–1648. пмид:25317845
  34. 34. Скобовиат С, Сломински А.Т. Ультрафиолет B стимулирует передачу сигналов проопиомеланокортина в аркуатном ядре гипоталамуса у мышей. Опыт Дерматол. 2016; 25: 120–123. пмид:26513428
  35. 35. Скобовиат С., Постлетуэйт А.Е., Сломински А.Т.Воздействие на кожу ультрафиолета B быстро активирует системные нейроэндокринные и иммунодепрессивные реакции. Фотохим Фотобиол. 2016;
  36. 36. Lee CM, Boileau AC, Boileau TW, Williams AW, Swanson KS, Heintz KA, et al. Обзор животных моделей в исследованиях каротиноидов. Дж Нутр. 1999 г.; 129: 2271–2277. пмид:10573562
  37. 37. Миядзава Т., Накагава К., Кимура Ф., Сато А., Миядзава Т. Концентрация каротиноидов в плазме до и после приема астаксантина у лиц среднего и старшего возраста.Биоски Биотехнолог Биохим. 2011 г.; 75: 1856–1858. пмид: 21897013
  38. 38. Роулингс А.В., Хардинг К.Р. Увлажнение и барьерная функция кожи. Дерматол Тер. 2004 г.; 17: 43–48. пмид:14728698
  39. 39. Сакабе Дж., Ямамото М., Хиракава С., Мотояма А., Охта И., Тацуно К. и др. Родственная калликреину пептидаза 5 участвует в протеолитическом процессинге профилаггрина в культивируемых кератиноцитах человека. Дж. Биол. Хим. 2013; 288: 17179–17189. пмид:23629652
  40. 40. Сандилендс А., Сазерленд С., Ирвин А.Д., Маклин WHI.Филаггрин на передовой: роль в барьерной функции кожи и заболеваниях. Дж. Клеточные науки. 2009 г.; 122: 1285–1294. пмид:19386895
  41. 41. Денекер Г., Оваере П., Ванденабиле П., Деклерк В. Каспаза-14 раскрывает свои секреты. Джей Селл Биол. 2008 г.; 180: 451–458. пмид:18250198
  42. 42. Yamamoto M. Miyai M, Matsumoto Y, Tsuboi R, Hibino T. Пептидаза-7, родственная калликреину, регулирует созревание каспазы-14 во время терминальной дифференцировки кератиноцитов, создавая промежуточную форму.Дж. Биол. Хим. 2012 г.; 287: 32825–32834. пмид:22825846
  43. 43. Беннет К. Каллард Р., Хейвуд В., Харпер Дж., Джаякумар А., Клейман Г.Л. и др. Новая роль LEKTI в формировании кожного барьера: безметочная количественная протеомная идентификация каспазы 14 как новой мишени для ингибитора протеазы LEKTI. J Протеом Res. 2010 г.; 9: 4289–4294. пмид:20533828
  44. 44. Элиас П.М., Уильямс М.Л., Чой Э.Х., Фейнгольд К.Р. Роль сульфата холестерина в структуре и функции эпидермиса: уроки Х-сцепленного ихтиоза.Биохим Биофиз Акта. 2014; 1841: 353–361. пмид:242
  45. 45. Эпштейн Э.Х., Уильямс М.Л., Элиас П.М. Эпидермальный цикл сульфата холестерина. J Am Acad Дерматол. 1984 год; 10: 866–868. пмид:6586754
  46. 46. Ма Т., Хара М., Суграт Р., Вербавац Дж. М., Веркман А. С. Нарушение гидратации рогового слоя у мышей, лишенных эпидермального водного канала аквапорина-3. Дж. Биол. Хим. 2002 г.; 277: 17147–17153. пмид:11880378
  47. 47. Накахигаси К., Кабашима К., Икома А., Веркман А.С., Миячи Ю., Хара-Чикума М.Дж.Активация аквапорина-3 участвует в пролиферации кератиноцитов и эпидермальной гиперплазии. Инвест Дерматол. 2011 г.; 131: 865–873.
  48. 48. Олссон М., Броберг А., Йернас М., Карлссон Л., Рудемо М., Сууркюла М. и др. Повышенная экспрессия аквапорина 3 при атопической экземе. Аллергия. 2006 г.; 61: 1132–1137. пмид:16

    8

  49. 49. Цюань Т., Цинь З., Ся В., Шао И., Вурхиз Дж.Дж., Фишер Г.Дж. Металлопротеиназы, разлагающие матрикс, при фотостарении. J Investig Dermatol Symp Proc.2009 г.; 14: 20–24. пмид:19675548
  50. 50. Мариани Т.Дж., Сандефур С., Роби Дж.Д., Пирс Р.А. Индукция коллагеназы-3 в фибробластах легких крыс требует комбинированного воздействия фактора некроза опухоли-альфа и метаболитов 12-липоксигеназы: модель ремоделирования внеклеточного матрикса, вызванного макрофагами и управляемого фибробластами, во время воспалительного повреждения легких. Мол Биол Селл. 1998 год; 9: 1411–1424. пмид:9614183
  51. 51. Бем М., Люгер Т.А., Тобин Д.Дж., Гарсия-Боррон Дж.К. Лиганды меланокортиновых рецепторов: новые горизонты для кожи.Джей Инвест Дерматол. 2006 г.; 126: 1966–1975.
  52. 52. Ламор С.Д., Вондрак Г.Т. Аутофагико-лизосомная дисрегуляция после инактивации катепсина B в фибробластах кожи человека, подвергшихся воздействию УФА. Фотохимия Photobiol Sci. 2012 г.; 11: 163–172. пмид: 21773629
  53. 53. Сломински А., Вортсман Дж., Люгер Т., Паус Р., Соломон С. Участие кортикотропин-рилизинг-гормона и проопиомеланокортина в реакции кожи на стресс. Physiol Rev. 2000; 80: 979–1020. пмид:10893429
  54. 54.Сломински А.Т., Змиевски М.А., Збитек Б., Тобин Д.Дж., Теохаридес Т.К., Ривье Дж. Ключевая роль CRF в системе реакции кожи на стресс. Эндокр, ред. 2013 г.; 34: 827–884. пмид:23939821
  55. 55. Бём М., Рагунат М., Сандеркоттер С., Шиллер М., Стендер С., Бжоска Т. и др. Метаболизм коллагена является новой мишенью нейропептида α-меланоцитостимулирующего гормона. Дж. Биол. Хим. 2004 г.; 279: 6959–6966. пмид:14645373
  56. 56. Кюттнер В., Мак С., Гретцмайер С., Брукнер-Тудерман Л., Денджель Дж.Потеря коллагена VII связана со снижением количества и активности трансглютаминазы 2. Джей Инвест Дерматол. 2014; 134: 2381–2389. пмид:24732400
  57. 57. Breithaupt DE, Weller P, Wolters M, Hahn A. Реакция плазмы на однократную дозу пищевых эфиров β-криптоксантина из папайи ( Carica papaya L.) или неэтерифицированного β-криптоксантина у взрослых людей: сравнительное исследование. Бр Дж Нутр. 2003 г.; 90: 795–801. пмид:13129448
  58. 58. Корал-Хиностроза Г.Н., Итрестбыла Т., Рюйтерб Б., Бьеркенг Б.Появление в плазме неэтерифицированных геометрических E/Z и оптических R/S изомеров астаксантина у мужчин, принимавших однократные дозы смеси оптических 3 и 3’R/S изомеров жирных ацилдиэфиров астаксантина. Comp Biochem Physiol C. 2004; 139: 99–110.
  59. 59. Петри Д., Лундебай А.К. Распределение астаксантина в тканях крыс после воздействия дозированных уровней в корме. Comp Biochem Physiol C. 2007; 145: 202–209.

Структурные особенности фотостарения у мышей, вызванного воздействием ультрафиолетового излучения А | Савич

Том 79, № 3 (2020)

Оригинальный артикул

Отправлено: 2019-09-02

Принято: 2019-10-22

Опубликовано онлайн: 2019-11-12

Посмотреть PDF-файл Скачать PDF-файл

Структурные характеристики фотостарения у мышей, вызванного воздействием ультрафиолетового излучения А

С.SAVIC 1 , S. SMILJIC 2 , S. LESTAREVIC 1 , A. ILIC 3 , M. Mijovic 4 , P. Mandic 5 , B. djerkovic 4

DOI: 10.5603/FM.a2019.0119

·

·

Фолиа Морфол 2020;79(3):548-556.

Принадлежности
  1. Кафедра гистологии и эмбриологии медицинского факультета Приштина, Косовска-Митровица, Сербия
  2. Кафедра физиологии, Медицинский факультет Приштины, Косовска-Митровица, Сербия
  3. Кафедра медицинской статистики и информатики, Медицинский факультет Приштины, Косовска-Митровица, Сербия
  4. Кафедра патологии, Медицинский факультет Приштины, Косовска-Митровица, Сербия
  5. Кафедра анатомии, медицинский факультет Приштина, Косовска-Митровица, Сербия

Том 79, № 3 (2020)

ОРИГИНАЛЬНЫЕ СТАТЬИ

Отправлено: 2019-09-02

Принято: 2019-10-22

Опубликовано онлайн: 2019-11-12

Аннотация

Справочная информация: Из-за глубокого проникновения в дерму ультрафиолетовое излучение А (UVA) считается основным фактором фотостарения кожи.Целью данного исследования является использование качественного и количественного анализа для определения структурных параметров фотостарения кожи у мышей, подвергшихся воздействию УФА-излучения, с нанесением фотозащитного крема или без него. Материалы и методы: Эксперимент заключался в облучении самок мышей BALBc в солярии УФА-лучами до суммарных доз 7800 Дж/см2 и 12500 Дж/см2. Всего 78 животных были разделены на четыре опытные и две контрольные группы. Все животные были выбриты, а животных двух экспериментальных групп за полчаса до облучения обработали фотозащитным кремом.Образцы обработанной кожи окрашивали гематоксилин-эозином и по Ван-Гизону. Все измерения, за исключением наличия дискератоза, проводились с использованием программного обеспечения ImageJ 150i. Результаты: В ходе исследования признаки фотостарения кожи были более очевидны в группах животных, не получавших лечения. Дискератоз чаще встречался в обеих нелеченных группах животных (р = 0,004 и р = 0,003). Наименьшие значения толщины эпидермиса (13,8 ± 2,6 мкм и 12,7 ± 2,3 мкм) имели место в обеих нелеченых группах животных (p < 0.001 и р < 0,001). Наибольшие значения толщины рогового слоя (34,3 ± 8,5 мкм) наблюдались в нелеченой, более короткой группе облученных животных (р < 0,001), облученных в течение наименьшего периода времени. Помимо контрольных групп, наибольшая длина дермо-эпидермального перехода была зарегистрирована в группе леченных, более длительно облученных животных (1467,6 ± 94,6 мкм; p = 0,373). Наименьшие значения толщины дермы (115,9 ± 10,5 мкм и 134,8 ± 21,8 мкм) и объемной плотности коллагеновых волокон (31.92 ± 3,19 % и 29,40 ± 4,54 %) присутствовали в обеих нелеченых группах животных (p < 0,001, p < 0,001, p = 0,035). Выводы: Фотостарение кожи было наиболее выражено в группах животных, облученных без применения фотозащитного крема.

Аннотация

Справочная информация: Из-за глубокого проникновения в дерму ультрафиолетовое излучение А (UVA) считается основным фактором фотостарения кожи.Целью данного исследования является использование качественного и количественного анализа для определения структурных параметров фотостарения кожи у мышей, подвергшихся воздействию УФА-излучения, с нанесением фотозащитного крема или без него. Материалы и методы: Эксперимент заключался в облучении самок мышей BALBc в солярии УФА-лучами до суммарных доз 7800 Дж/см2 и 12500 Дж/см2. Всего 78 животных были разделены на четыре опытные и две контрольные группы. Все животные были выбриты, а животных двух экспериментальных групп за полчаса до облучения обработали фотозащитным кремом.Образцы обработанной кожи окрашивали гематоксилин-эозином и по Ван-Гизону. Все измерения, за исключением наличия дискератоза, проводились с использованием программного обеспечения ImageJ 150i. Результаты: В ходе исследования признаки фотостарения кожи были более очевидны в группах животных, не получавших лечения. Дискератоз чаще встречался в обеих нелеченных группах животных (р = 0,004 и р = 0,003). Наименьшие значения толщины эпидермиса (13,8 ± 2,6 мкм и 12,7 ± 2,3 мкм) имели место в обеих нелеченых группах животных (p < 0.001 и р < 0,001). Наибольшие значения толщины рогового слоя (34,3 ± 8,5 мкм) наблюдались в нелеченой, более короткой группе облученных животных (р < 0,001), облученных в течение наименьшего периода времени. Помимо контрольных групп, наибольшая длина дермо-эпидермального перехода была зарегистрирована в группе леченных, более длительно облученных животных (1467,6 ± 94,6 мкм; p = 0,373). Наименьшие значения толщины дермы (115,9 ± 10,5 мкм и 134,8 ± 21,8 мкм) и объемной плотности коллагеновых волокон (31.92 ± 3,19 % и 29,40 ± 4,54 %) присутствовали в обеих нелеченых группах животных (p < 0,001, p < 0,001, p = 0,035). Выводы: Фотостарение кожи было наиболее выражено в группах животных, облученных без применения фотозащитного крема.

Полный текст:
Посмотреть PDF-файл Скачать PDF-файл
Ключевые слова

фотостарение; фотозащита; облучение; ИмиджДж; мыши

Об этой статье
Титул

Структурные характеристики фотостарения у мышей, вызванного воздействием ультрафиолетового излучения А

Журнал

Морфологический лист

Выпуск

Том 79, № 3 (2020)

Тип изделия

Оригинальный артикул

страниц

548-556

Опубликовано онлайн

12.11.2019

просмотров страниц

892

просмотров/загрузок статьи

472

ДОИ

10.5603/FM.a2019.0119

Опубликовано

31724149

Библиографическая запись

Фолиа Морфол 2020;79(3):548-556.

Ключевые слова

фотостарение
фотозащита
облучение
ImageJ
мыши

Авторов

С.Савич
С. Смилич
С. Лестаревич
А. Илич
М. Мийович
П. Мандич
Б. Джеркович

Ссылки (43)
  1. Амано С.Характеристика и механизмы фотостарения кожи. Повреждения базальной мембраны и дермальных структур. Опыт Дерматол. 2016; 25 Приложение 3: 14–19.
  2. Амаро-Ортис А., Ян Б., Д’Орацио Дж.А. Ультрафиолетовое излучение, старение и кожа: профилактика повреждений путем местного воздействия на цАМФ. Молекулы. 2014; 19(5): 6202–6219.
  3. Батти С., Дзицукава С., Бернерд Ф. и др.Новое понимание фотостарения, повреждений, вызванных УФ-А, и типов кожи. Опыт Дерматол. 2014; 23 Приложение 1: 7–12.
  4. Battie C, Verschoore M. Воздействие солнечного ультрафиолета на кожу и клинические аспекты фотоповреждения. Индийский J Дерматол Венереол Лепрол. 2012 г.; 78 Приложение 1: S9–SS14.
  5. Беани Дж.К. [Ультрафиолет А-индуцированное повреждение ДНК: роль в раке кожи].Bull Acad Natl Med. 2014; 198(2): 273–295.
  6. Bertsch S, Csontos K, Schweizer J, et al. Влияние механической стимуляции на пролиферацию клеток эпидермиса мыши и на регуляцию роста эндогенными факторами (халоны). Кинет клеточной ткани. 1976 год; 9(5): 445–457.
  7. Билач С., Шахин М.Т., Озтюрккан С. Хроническое актиническое поражение кожи лица.Клин Дерматол. 2014; 32(6): 752–762.
  8. Bosch R, Philips N, Suárez-Pérez JA и др. Механизмы фотостарения и фотоканцерогенеза кожи, а также стратегии фотозащиты с помощью фитохимических веществ. Антиоксиданты (Базель). 2015 г.; 4(2): 248–268.
  9. Каберлотто Э., Руис Л., Миллер З. и др. Влияние устройства для массажа кожи на экспрессию белков дермы человека ex-vivo и морщины лица in-vivo.ПЛОС Один. 2017; 12(3): e0172624.
  10. Chen CYO, Smith A, Liu Y, et al. Фотозащита биоактивными веществами фисташки в трехмерной модели ткани, эквивалентной коже человека. Int J Food Sci Nutr. 2017; 68(6): 712–718.
  11. Чен Дж., Луо Дж., Тан Ю и др. Влияние низких доз АЛК-ФДТ на фотостарение фибробластов, вызванное облучением УФ-А, и основные механизмы.Фотодиагностика Фотодин Тер. 2019; 27: 79–84.
  12. Cortat B, Garcia CC, Quinet A, et al. Относительная роль повреждений ДНК, вызванных УФ-излучением в клетках человека. Фотохимия Photobiol Sci. 2013; 12 (8): 1483–1495.
  13. Дуарте И., Роттер А., Малвестити А. и др. Роль стекла как барьера против пропускания ультрафиолетового излучения: экспериментальное исследование.Фотодерматол Фотоиммунол Фотомед. 2009 г.; 25(4): 181–184.
  14. Dupont E, Gomez J, Bilodeau D. Помимо УФ-излучения: кожа под угрозой. Int J Cosmet Sci. 2013; 35(3): 224–232.
  15. Экхарт Л., Чахлер Э., Грубер Ф. Аутофагический контроль старения кожи. Front Cell Dev Biol. 2019; 7: 143.
  16. Evans-Johnson JA, Garlick JA, Johnson EJ, et al.Пилотное исследование фотозащитного эффекта фитохимических веществ миндаля в трехмерном эквиваленте кожи человека. J Photochem Photobiol B. 2013; 126: 17–25.
  17. Гомес-Нето А., Агилера П., Прието Л. и др. Эффективность ежедневного защитного увлажняющего крема с высокой фотозащитой от УФ-В и УФА-излучения в снижении повреждения ультрафиолетом: оценка с помощью отражательной конфокальной микроскопии. Акта Дерм Венерол. 2017; 97 (10): 1196–1201.
  18. Гонзага ER.Роль УФ-излучения в фотоповреждении, старении кожи и раке кожи: важность фотозащиты. Am J Clin Дерматол. 2009 г.; 10 Приложение 1: 19–24.
  19. Harberts E, Fishelevich R, Liu J, et al. MyD88 опосредует решение умереть в результате апоптоза или некроптоза после УФ-облучения. Врожденный иммун. 2014; 20(5): 529–539.
  20. Хунг К.Ф., Фанг К.Л., Аль-Сувайех С.А. и др.Оценка проникновения лекарственного средства и солнцезащитного крема через кожу, облученную УФ-А и УФ-В: сравнение нормальной кожи и хронологически состарившейся кожи. J Дерматол Sci. 2012 г.; 68(3): 135–148.
  21. Каммейер А., Луитен Р.М. События окисления и старение кожи. Старение Res Rev. 2015; 21: 16–29.
  22. Карран П., Брем Р. Окисление белков, УФА и восстановление ДНК человека.Восстановление ДНК. 2016; 44: 178–185.
  23. Хавкин Дж., Эллис ДАФ. Старение кожи: гистология, физиология и патология. Пластмасса для лица Surg Clin North Am. 2011 г.; 19(2): 229–234.
  24. Клигман Л.Х., Гебре М., Альпер Р. и др. Метаболизм коллагена в коже безволосых мышей, облученных ультрафиолетом, и его корреляция с гистохимическими наблюдениями. Джей Инвест Дерматол.1989 год; 93(2): 210–214.
  25. Клигман Л. Модель безволосой мыши для фотостарения. Клин Дерматол. 1996 год; 14(2): 183–195.
  26. Lagarrigue SG, George J, Questel E, et al. In vivo количественная оценка пигментации эпидермиса и плотности сосочков дермы с помощью отражательной конфокальной микроскопии: изменения в зависимости от возраста и фототипа кожи. Опыт Дерматол.2012 г.; 21(4): 281–286.
  27. Lan CCE, Hung YT, Fang AH и др. Влияние облучения на старение кожи, вызванное УФ-А. J Дерматол Sci. 2019; 94(1): 220–228.
  28. Leccia MT, Lebbe C, Claudel JP, et al. Новое видение фотозащиты и фоторемонта. Дерматол Тер (Хайдельб). 2019; 9(1): 103–115.
  29. Лю И, Чан Ф, Сунь Х и др.Ресвератрол защищает клетки HaCaT кератиноцитов человека от вызванного УФА повреждения окислительного стресса путем подавления экспрессии Keap1. Евр Дж Фармакол. 2011 г.; 650(1): 130–137.
  30. Лонго С., Казари А., Беретти Ф. и др. Старение кожи: микроскопическая оценка эпидермальных и дермальных изменений in vivo с помощью конфокальной микроскопии. J Am Acad Дерматол. 2013; 68(3): e73–e82.
  31. Marionnet C, Pierrard C, Lejeune F, et al.Модуляции экспрессии генов, вызванные ежедневным ультрафиолетовым светом, можно предотвратить с помощью солнцезащитного крема широкого спектра действия. J Photochem Photobiol B. 2012; 116: 37–47.
  32. Mouret S, Leccia MT, Bourrain JL, et al. Индивидуальная фоточувствительность кожи человека и УФА-индуцированные пиримидиновые димеры в ДНК. Джей Инвест Дерматол. 2011 г.; 131 (7): 1539–1546.
  33. Нечифор М.Т., Никулице К.М., Урс А.О. и др.Облучение УФ-А диспластических кератиноцитов: окислительное повреждение против антиоксидантной защиты. Int J Mol Sci. 2012 г.; 13 (12): 16718–16736.
  34. Оу-Янг Х., Стаматас Г., Коллиас Н. Вклад кожи в вызванный УФ-А окислительный стресс в коже. Фотодерматол Фотоиммунол Фотомед. 2009 г.; 25(2): 65–70.
  35. Паттисон Д.И., Рахманто А.С., Дэвис М.Дж.Фотоокисление белков. Фотохимия Photobiol Sci. 2012 г.; 11(1): 38–53.
  36. Питтаяпруек П., Мифансан Дж., Прапапан О. и др. Роль матриксных металлопротеиназ в фотостарении и фотоканцерогенезе. Int J Mol Sci. 2016; 17(6).
  37. Prasedya ES, Syafitri SM, Geraldine BA, et al. UVA фотозащитная активность бурых макроводорослей.Биомедицины. 2019; 7(4): 77.
  38. Куан Т., Литтл Э., Куан Х. и др. Повышенный уровень металлопротеиназ матрикса и фрагментация коллагена в фотоповрежденной коже человека: влияние измененного микроокружения внеклеточного матрикса на функцию дермальных фибробластов. Джей Инвест Дерматол. 2013; 133 (5): 1362–1366.
  39. Rünger TM, Farahvash B, Hatvani Z, et al.Сравнение реакции на повреждение ДНК после эквимутагенных доз УФ-А и УФ-В: менее эффективная остановка клеточного цикла с УФА-излучением может сделать индуцированные УФ-А пиримидиновые димеры более мутагенными, чем димеры, индуцированные УФ-В. Фотохимия Photobiol Sci. 2012 г.; 11(1): 207–215.
  40. Schuch AP, Lago JC, Yagura T, et al. Дозиметрическая оценка ДНК для солнцезащитной генотоксичной фотозащиты. ПЛОС Один. 2012 г.; 7(6): e40344.
  41. Скотт Т.Л., Кристиан П.А., Кеслер М.В. и др.Независимое от пигмента цАМФ-опосредованное утолщение эпидермиса защищает кожу от УФ-повреждения за счет пролиферации кератиноцитов. Опыт Дерматол. 2012 г.; 21(10): 771–777.
  42. Wurm EMT, Longo C, Curchin C, et al. In vivo оценка хронологического старения и фотостарения кожи предплечий с помощью отражательной конфокальной микроскопии. Бр Дж Дерматол. 2012 г.; 167(2): 270–279.
  43. Ся К., Чан Х.М., Инь Дж.Дж. и др.Фотооблучение УФА метаболитов бензо[а]пирена: индукция цитотоксичности, активных форм кислорода и перекисного окисления липидов. Токсикол Инд Здоровье. 2015 г.; 31(10): 898–910.

Солнце и кожа: морщины и последствия фотостарения

Вдруг однажды, глядя на себя в зеркало, вот они: какие-то тонкие линии вокруг глаз, морщинка посередине лба, которую мы не заметили до настоящего времени.Рано или поздно это случается с каждым и было бы бесполезно отрицать, что это вообще плохой удар: с первой же морщинкой ты вдруг чувствуешь себя чуть менее молодым и привлекательным. Потому что морщины – это явный признак старения.
 
Что вызывает морщины
Основные причины появления морщин связаны со старением кожи: со временем кожные волокна коллагена и эластина, которые фактически составляют каркас нашей кожи, изменяются и теряют эластичность. Процесс включает в себя «дезорганизацию» сети волокон , поддерживающих кожу, которая, становясь менее эластичной, отмечается прежде всего в точках, где наблюдается большее напряжение для выразительности. В начале процесса тонкие линии образовались специально как знаки выражения; когда они становятся глубже, мы говорим о настоящих морщинах.
Потеря эластичности кожи начинается в среднем в возрасте около тридцати (но генетика сильно влияет на момент появления морщин, а также на их обилие) и со временем увеличивается, при этом некоторые факторы могут способствовать ухудшению ситуации такие как:

плохое увлажнение: со временем кожа теряет способность удерживать воду, а обезвоживание делает поверхностный слой эпидермиса более хрупким, а морщины более заметными;
изменение гормональной структуры : при менопаузе эстрогены снижаются, а вместе с ними выработка коллагена, поэтому ускоряется образование морщин;
воздействие солнца : избыток солнца способствует фотостарению или старению кожи в целом (включая, например, появление пятен на коже), а также образованию морщин и тонких линий;
загрязнение : воздействие загрязняющих веществ, смога и т. д. приводит к контакту свободных радикалов с кожей, что ускоряет старение, включая появление морщин;
курение: морщины типа «штрих-код» вокруг губ являются типичными и связаны как с сокращением мышц, удерживающих сигарету во рту, так и с локальным накоплением загрязняющих токсинов, присутствующих в дыме.
 
В частности, пребывание на солнце можно рассматривать как палку о двух концах, с одной стороны оно приносит нашему организму много пользы, от увеличения выработки витамина D, необходимого для здоровья организма, до что серотонин, гормон хорошего настроения. Но, в то же время, УФ-лучи вызывают фотостарение и, как следствие, старение кожи.
 
Термин фотостарение относится к старению кожи, вызванному хроническим повреждением в результате воздействия на кожу солнечного света , что может привести как к изменениям клеточной ДНК под действием свободных радикалов, так и к повреждению коллагена с последующим появлением более глубоких морщины и дряблость кожи.
 
Как предотвратить появление морщин
Предотвратить появление первых признаков старения можно с помощью правильного питания и тщательного ухода за кожей. Очевидно, что профилактика не означает, что морщины не появятся рано или поздно, но вы можете попытаться отсрочить их появление и противодействовать их прогрессированию с годами.
 
В дополнение ко всему этому, даже целенаправленные процедуры могут иметь значение: микромассаж лица, возможный с помощью icoone, помимо того, что он полностью неинвазивен и не имеет побочных эффектов, улучшает кровообращение кожи, активируя фибробласты, чтобы гарантировать адекватное производство эластичных волокон и коллагена , чтобы дольше сохранять эластичность кожи. icoone очень эффективен для улучшения внешнего вида морщин после того, как они образовались, но если вы начнете использовать средство, когда появятся только первые тонкие морщинки, вы сможете иметь гладкую кожу намного, намного дольше.

Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован.