Очаговое шелушение кожи: Диагностика и лечение атопического дерматита и псориаза

Содержание

причины, симптомы и лечение в статье педиатра Похлебкина А. А.

Дата публикации 19 февраля 2021Обновлено 26 апреля 2021

Определение болезни. Причины заболевания

Эксфолиативный кератолиз — это очаговое симметричное шелушение кожи на ладонях, поверхности пальцев и, реже, на подошвах. Заболевание характеризуется сухостью кожи и поверхностными пузырями, заполненных воздухом.

Также эксфолиативный кератолиз называют рецидивирующей фокальной ладонной десквамацией, сухим пластинчатым дисгидрозом и рецидивирующей ладонной десквамацией.

 

Заболевание широко распространено и часто носит хронический, но доброкачественный характер. Эксфолиативный кератолиз чаще встречается у детей и подростков, реже у взрослых. Нередко его ошибочно принимают за псориаз, экзему или хронический контактный дерматит. У людей с повышенной потливостью рук состояние ухудшается в тёплую погоду и может быть связано с гипергидрозом — усиленным потоотделением [1].

Ранее эксфолиативный кератолиз называли дисгидротической экземой, и считалось, что заболевание вызвано нарушением работы потовых желёз. Эта связь уже опровергнута, но термин «дисгидротическая экзема» всё ещё используется [2].

Дисгидротическая экзема, также называемая помфоликсом, может предшествовать эксфолиативному кератолизу. При этом состоянии на пальцах рук, ног, ладонях и подошвах образуются волдыри, наполненные жидкостью, и возникает сильный зуд [2]. Причина дисгидротической экземы неизвестна, но, вероятно, на развитие заболевания влияет множество факторов. В большинстве случаев причину и предрасполагающий фактор выделить невозможно [17].

Причины

эксфолиативного кератолиза

Предполагалось, что экфолиативный кератолиз может быть вызван грибковым поражением, но в дальнейших исследованиях эта гипотеза не подтвердилась.

Возможные провоцирующие факторы эксфолиативного кератолиза:

  • трение и контакт с водой [3][6];
  • мыло, моющие средства и растворители: химические вещества, содержащиеся в них, могут привести к появлению трещин и пузырей на руках;
  • аллергия: продукты питания, загрязнение воздуха и другие вещества могут спровоцировать появление аллергии на коже;
  • стресс: может не только вызвать, но и усугубить течение болезни;
  • жаркий климат: при тёплой погоде потоотделение усиливается, что может привести к шелушению кожи;
  • воздействие солёной воды;
  • сухость кожи.

Эксфолиативный кератолиз не связан с дефицитом какого-либо витамина. Встречаются семейные случаи заболевания, однако генетическая роль в развитии эксфолиативного кератолиза изучена недостаточно [14].

При обнаружении схожих симптомов проконсультируйтесь у врача. Не занимайтесь самолечением — это опасно для вашего здоровья!

Симптомы эксфолиативного кератолиза

Эксфолиативный кератолиз часто протекает без выраженных симптомов и проявляется незначительным поражением кожи ладонно-подошвенной области [5]. Отшелушиванию кожи предшествует появление наполненных воздухом пузырей, которые никогда не бывают заполнены жидкостью [3]. В некоторых случаях заболевание начинается только с очагового шелушения кожи, без образования пузырей.

После вскрытия пузырей остаются широкие сетчатые, круглые или овальные очаги. Они шелушатся, распространяются по периферии и образуют большие округлые участки, напоминающие кружева.

 

Участки слущенного эпителия теряют защитную функцию, становятся красными, сухими и покрываются трещинками. Шелушению может предшествовать небольшой зуд или жжение, в некоторых случаях область слущенного эпителия становится болезненной [3].

Высыпания всегда симметричные. Иногда на кончиках пальцев образуются глубокие трещины, кожа становится жёсткой и немеет — в таком случае для полного заживления потребуется 1—3 недели. Эксфолиативный кератолиз может повториться через несколько недель после того, как на месте отшелушивания образовалась новая кожа.

Патогенез эксфолиативного кератолиза

Эпидермис — верхний наружный слой кожи, состоящий из кератиноцитов. Эти клетки содержат белок кератин, необходимый для прочности и эластичности кожи. Когда кератин разрушается, прочность кожи снижается, из-за чего она начинает шелушиться.

Также в эпидермисе содержатся корнеодесмосомы — белковые структуры, которые соединяют кератиноциты в сеть. В верхнем роговом слое кожи количество таких структур обычно уменьшается. Это нормальный физиологический процесс. Он называется десквамацией. Благодаря нему клетки кожи отшелушиваются, при этом поддерживается постоянная толщина рогового слоя [8].

 

Исследование 24 пациентов с эксфолиативным кератолизом показало, что заболевание может возникать из-за дисбаланса активности ферментов, участвующих в процессе десквамации, особенно на коже ладоней [3].

Точный механизм развития эксфолиативного кератолиза неизвестен. Прояснить возможные генетические или приобретённые причины заболевания помогут дальнейшие исследования десквамационных ферментов и ингибиторов — веществ, подавляющих или задерживающих течение ферментативных процессов. К таким веществам относятся ингибитор секреторной лейкоцитарной протеазы (SLPI), альфа-2 макроглобулин-1 (A2ML1), сульфат холестерина и ион цинка.

Классификация и стадии развития эксфолиативного кератолиза

По МКБ-10 (Международной классификации болезней) дерматологи часто кодируют эксфолиативный кератолиз как L26, относя заболевание к «другим эксфолиативным состояниям».

Классификации и стадийности эксфолиативный кератолиз не имеет. Заболевание иногда может приобретать хроническое течение с периодами ремиссии и обострения.

Осложнения эксфолиативного кератолиза

Эксфолиативный кератолиз не вызывает системных проявлений или осложнений. При заболевании может повреждаться кожа, в результате чего присоединяется бактериальная инфекция. Её признак — красные пятна, которые превращаются в гнойнички и пузырьки. Пузырьки безболезненные и легко вскрываются, образуются желтоватые чешуйки, так называемые «медовые корочки». При этом может возникать зуд.

 

Диагностика эксфолиативного кератолиза

Диагноз «эксфолиативный кератолиз» ставится на основании данных клинического обследования и сбора анамнеза [15]. Некоторые пациенты отмечают, что состояние усугубляется после воздействия химических или физических раздражителей, таких как вода, мыло и моющие средства. Другие ассоциируют шелушение кожи с повышенным потоотделением.

Эксфолиативный кератолиз, вероятно, распространён, но часто протекает бессимптомно, поэтому врачи его наблюдают редко.

При осмотре отмечаются симметричные округлые участки шелушения на ладонях и, реже, на стопах. При этом воспаление на коже отсутствует.

Обычно дополнительное диагностическое тестирование не требуется. Однако в более сложных случаях, при подозрении на грибковое поражение, может потребоваться исследование с гидроксидом калия (KOH).

Биопсия кожи при кератолизе показывает расщепление и частично разрушенные корнеодесмосомы в роговом слое.

Патч-тесты, оценивающие потенциальную контактную аллергию, при эксфолиативном кератолизе отрицательны.

Дифференциальную диагностику проводят со следующими заболеваниями:

  • различные формы дерматита рук, включая контактный дерматит, — для него характерен зуд, воздействие провоцирующих факторов в анамнезе, положительный ответ на гормональные мази;
  • дисгидроз — сопровождается зудом, появлением трещин и везикул, наполненных жидкостью;
  • псориаз — бляшки с чёткими границами бордово-красного цвета, выступающие над поверхностью кожи;
  • дерматофития рук — изменение ногтей на руках и ногах, положительный ответ на противогрибковые препараты, не всегда симметричное поражение;
  • простой буллёзный эпидермолиз — пузыри на разных участках кожи младенцев, возникающие после трения;
  • ограниченный ладонный гипокератоз — редкое состояние, характеризуется центральной розовой областью с тонкой кожей на ладонях или подошвах стопы, по краям резкий переход к нормальной коже;
  • пальмоплантарная кератодерма — возникает на коже стоп и кистей, характеризуется выраженным утолщением кожи [11];
  • синдром акрального шелушения кожи — генетическое заболевание с пожизненным отслаиванием кожи.

Лечение эксфолиативного кератолиза

Причин возникновения эксфолиативного кератолиза может быть несколько, и не всегда они очевидны. Поэтому лечение болезни направлено на устранение симптомов и усугубляющих факторов. Это достигается защитой рук от физических или химических раздражителей ношением перчаток, когда это возможно.

Активное увлажнение кожи — важный, безопасный и эффективный метод лечения [10]. Наиболее подходящим способом для большинства пациентов являются кератолитические кремы, содержащие мочевину, молочную кислоту, лактат аммония или салициловую кислоту. Кремы с мочевиной увлажняют кожу и предотвращают её сухость. Кремы могут содержать мочевину 20 % или 40 %, 12 % лактата аммония, 6 % салициловой кислоты и 12 % молочной кислоты. Любой из них применяют до двух раз в день.

 

Приём наружных гормональных препаратов (стероидов) не требуется, так как воспаление отсутствует.

В некоторых исследованиях упоминается использование фотохимиотерапии с псораленом и ультрафиолетовым светом (PUVA), но только при тяжёлых случаях, так как риски этой терапии превышают пользу [9].

PUVA-терапия заключается в приёме пациентом фотоактивного материала псоралена с последующим воздействием на кожу UVA лучей. Данных, подтверждающих пользу фототерапии при эксфолиативном кератолизе, на сегодняшний день недостаточно.

Возможные побочные эффекты PUVA-терапии: покраснение кожи вплоть образования пузырей, зуд; к редкими побочными эффектам относятся головная боль, головокружение, учащённое сердцебиение и слабость [4].

Также в литературе встречаются данные о лечении эксфолиативного кератолиза ацитретином [7][14]. Но для рутинного применения ацитретина в качестве лечения кератолиза информации пока недостаточно. Ацитретин — это производное витамина А, которым лечат псориаз.

Прогноз. Профилактика

Прогноз благоприятный. Обычно симптомы эксфолиативного кератолиза проходят самостоятельно или после прекращения контакта с провоцирующим фактором. Спустя несколько недель или месяцев формируется здоровая кожа. Однако через несколько недель может возникнуть рецидив.

Иногда кератолиз приобретает хронический характер и длится много лет подряд. В таком случае заболевание трудно поддаётся лечению. С возрастом эксфолиативный кератолиз возникает реже [2].

Меры профилактики:

  • избегать веществ, которые способствуют шелушению, например растворителей, антибактериального мыла и некоторых тканей;
  • соблюдать гигиену рук и ног с частой стрижкой ногтей — это поможет избежать вторичного инфицирования;
  • использовать перчатки при контакте с химическими веществами;
  • наносить увлажняющие кремы для рук, особенно полезны кремы, содержащие мочевину, молочную кислоту или силикон.
 

Роль продуктов питания в развитии эксфолиативного кератолиза не доказана, поэтому соблюдать диету не нужно.

Консультация врача трихолога в Челябинске в сети салонов «8 чудо»

ТРИХОЛОГИ В ЧЕЛЯБИНСКЕ.

                            

Трихолог в Челябинске — это специалист с высшим медицинским образованием: врач дерматовенеролог или врач косметолог, прошедший дополнительную профессиональную подготовку по циклу «Трихология». 

Все трихологи в Челябинске в клинике «8 чудо» являются членами Ассоциации трихологов Российской федерации. Наши врачи трихологи имеют стаж работы от 5-10 лет и более.

Когда необходимо обратиться на прием к трихологу в Челябинске?
Предлагаем Вам ответить на несколько важных вопросов:

  • Выпадение волос более 100-120 в сутки
  • Диффузное или очаговое выпадение волос
  • Перхоть, зуд и шелушение кожи головы
  • Тонкие и секущиеся волосы на голове
  • Уменьшение объема волос на голове
  • Повышенная чувствительность к шампуням, к воде
  • Жирные волосы

Если у Вас есть один из этих симптомов, тогда Вам необходим трихолог.
Не теряйте время зря, ведь все эти симптомы усиливаются с каждым днем, а через 2-3 года рост волос вообще прекращается на данном участке, так как не работающие фолликулы со временем просто запаиваются.
Клиника «8 чудо» располагает самыми новейшими методами диагностики кожи головы и волос:
  • Компьютерная трихоскопия
  • 3 Д компьютерная фототрихоскопия
  • Проведение спектрального анализа волос
  • Исследование волос и кожи головы методом флуоресценции на наличие грибкового поражения волосистой части головы.
  • Количественное исследование волос на 46 микроэлементов.
  • Биохимическое исследование крови.
  • Исследование гормонального статуса

Честные ответы врача трихолога на самые актуальные проблемы, связанные с уходом за волосами. 


Как часто можно мыть голову при жирной кожи волосистой части головы?                                                              Голову необходимо мыть по мере ее загрязнения и усиления ее жирности.Для мытья головы используют только шампунь для жирной кожи.Температура воды не должна быть горячей, так как высокая температура усиливает выработку кожного сала. А холодная вода обладает плохими моющими свойствами и не обезжиривает волос. Поэтому температура воды для мытья головы должна быть в пределах 40-60 градусов.Голову необходимо мыть в утренние часы, но не вечером, так как в 4-5 утра происходит максимальная выработка кожного сала.Один раз в неделю необходимо проводить пилинг (или скрабирование) волосистой части головыПри очень жирной кожи необходимо использовать дополнительно лосьоны (тоники) с подсушивающими свойствами.

Насколько опасны шампуни с содержанием силикона?
Добавление силикона в шампунь придает волосам красивый эстетический эффект. Использование современных шампуней с силиконом не опасны для использования. Но при наличии заболеваний и проблем с волосами необходимо проконсультироваться с врачом трихологом.

Можно ли использовать сульфатные шампуни при жирной кожи волосистой части головы?


Нужно. Кроме того, они эффективны при шелушении и зуде волосистой части головы.

На что обратить внимание при выборе шампуни?
При выборе шампуни необходимо ориентироваться только на тип кожи.

Почему чешется голова после мытья головы?
Наиболее частой причиной является непереносимость некоторых компонентов, содержащихся в данном шампуне. Вывод один: меняйте шампунь, но если и это не помогает, то необходимо обратиться к врачу трихологу.

Как долго после родов могут выпадать волосы и что делать?
После родов на 3-4 месяце могут начать сильно выпадать волос, но это не повод расстраиваться, так как это естественный процесс и связан он с гормональной перестройкой 

организма. Но в течение года процесс должен нормализоваться. Но если этого не происходит к концу году, то необходимо обратиться к врачу трихологу.

ВРАЧ ТРИХОЛОГ


Врачи трихологи в нашем центре занимаются диагностикой и лечением волос. Волос — это индикатор нашего внутреннего здоровья. Причин заболевания очень много.

К ним относятся:

  • Исследование заболевания гормональной сферы: щитовидной железы, надпочечников, яичников;

  • Заболевания желудочно-кишечного тракта;

  • Ослабление имунитета;

  • Неправильный уход за волосами.

  • Аутоиммунные заболевания.

Какая проблема у Вас сможет решить только врач трихолог после детального осмотра и проведения ряда диагностических исследований.

Затем только назначается соответствующее лечение.

Наши врачи трихологи назначают грамотное обследование без поиска несуществующих проблем и лечение эффективными препаратами.

Врач трихолог необходим при первых же признаках заболевания волос.

Наши врачи трихологи в Челябинске в клинике «8 чудо» для лечения заболевания волос применяют следующие современные проверенные методики:

  • Медикаментозное лечение.
  • Мезотерапию волос.

  • Плазмотерапию волос.

  • Озонотерапию волос (подкожные мультиинъекции озоно-кислородной смеси)

  • Микротоковую терапию.

  • Электроимпульсную терапию волосистой части головы.

  • Безинъекционную мезотерапию (электропорация).

  • Ионофорез с лекарственными препаратами.

  • Криотерапию.

  • Дарсонвализацию.

  • Использование лечебных сывороток для восстановления структуры волосяного фолликула.

Обратите внимание: Не начинайте лечение, пока Вас не посмотрит трихолог. Все специалисты являются членами Ассоциации трихологов РФ. Стаж работы всех врачей от 5 лет.   

Шелушится кожа у кошки — симптомы, лечение, препараты, причины появления

Шелушение кожи — это признак большинства кожных заболеваний и некоторых внутренних патологий. Один из самых распространенных кожных симптомов, которые у кошки не так-то просто заметить. Заметнее признаки шелушения у животных с темным и черным окрасом.

Признаки шелушения

Шелушение — это образования на поверхности кожи чрезмерного количества омертвевшего эпителия. В процессе шелушения задействованы 2 механизма:

  • избыточное ороговение;
  • чрезмерное отторжение эпителиальных тканей.

Шелушение может возникать на фоне истончения кожного покрова либо его утолщения. Достаточно часто процессу сопутствует зуд, который заставляет кошку чесаться и приводить свою кожу в еще худшее состояние. Расчесы, при попадании в ранки болезнетворных бактерий, могут стать причиной бактериального воспаления кожи.

Шелушение возникает вследствие несвойственного для организма кота омертвения рогового слоя кожи. Омертвение вызывается неблагоприятными факторами внешней среды или внутренними патологиями.

Причины шелушения

Факторы, которые приводят к шелушению, принято делить на внешние и внутренние.

  • К внешним относят физические, химические, инфекционно-паразитарные и механические факторы.
  • К внутренним принято относить недостаток витаминов, стрессы, заболевания системы крови, болезни системы пищеварения и эндокринопатии и генетическую предрасположенность.

Внешние причины нарушения

Эти факторы, вызывают раздражение кожи и ее шелушение при непосредственном контакте с ней. Обычно достаточно устранить такой фактор и кожный покров вернется в норму.

Физические факторы

Солнечный свет в избытке, высокие и низкие температуры, недостаточная влажность воздуха в помещении, где содержится животное, может приводить к чрезмерному ороговению эпидермиса и активному слущиванию верхнего слоя кожи.

Химические причины

Это агрессивные вещества: кислоты, щелочи и другие реагенты, агрессивно влияющие на кожу животного. Такие вещества способны вызывать не только шелушение, но и дерматиты, экзему и атопии.

В эту группу можно отнести не только кислоты или щелочи, но и шампуни или другие средства по уходу за кожей и шерстью животного, которые могут раздражающе действовать на эпидермальный слой. Достаточно часто шелушение начинается вследствие чрезмерного ухода за кожей животного с помощью косметических средств.

Инфекционно-паразитарные факторы

В эту группу относят большое количество паразитарных инфекций, которые не так уж и редки. Топ три подобных причин плачевного состояния кожи животного венчают: последствия блошиного дерматита, вши и демодекоз (поражение мелким кожным клещом). Кроме шелушения, эти патологии сопровождаются сильным зудом, потерей шерсти животным, высыпаниями (пузырьками, корками), расчесами. В шерсти животного обнаруживают яйца паразитов и продукты их жизнедеятельности.

Глистные инвазии становятся причиной кожного зуда, шелушения и ухудшения качества шерсти. Это происходит, потому что паразиты нарушают процессы пищеварения, механически мешая продвижению пищи по системе пищеварения. И они же поглощают питательные вещества, приводя к авитаминозам. Наличие глистов в организме кота приводит к диспепсии, а иногда рвоте и поносу.

Грибковые инфекции (в числе, стригущий лишай, малассезиоз) в обязательном порядке сопровождаются шелушением. Хотя первый симптом, на который в этом случае обращает внимание владелец — это облысение. Первые очаги обычно обнаруживаются на голове и морде животного. При малассезиозе заметно засаливание на ушах и пигментация кожи.

Механические факторы

К механическим причинам шелушения относят ссадинки, царапины, следы трения. Иногда кожа шелушится в местах инъекций. В этом случае обычно наблюдается очаговая алопеция. На месте травмированной кожи образуется корка, эпидермис становится грубым. Вокруг места повреждения кожа начинает шелушиться.

Внутренние причины

В первую тройку причин, приводящих к ухудшению состояния кожи, можно отнести погрешности рациона, болезни системы пищеварения и психогенное шелушение.

Погрешности в питании животного приводят к авитаминозам/гиповитаминозам либо аллергии.

Кроме указанных причин, шелушение может развиться вследствие эндокринопатий, иммунодефицита, аутоиммунных процессов, болезней системы крови и сальных желез. У некоторых животных есть наследственная склонность к чрезмерному ороговению эпидермиса.

Нарушения работы органов пищеварения

Подобные нарушения начинаются с диспепсии и расстройства стула. Животное беспокоит метеоризм, рвота. Кот худеет. Ухудшение качества шерсти и кожи, шелушение, появление высыпаний (пузырьков и корок), зуд — вторичны. Они возникают вследствие дефицита поступления питательных веществ в ткани. Дефицит образуется потому, что система пищеварения теряет способность правильно и полноценно расщеплять, всасывать и усваивать пищу.

Психогенное шелушение

Для этого типа нарушения характерны симметричные очаги выпадения шерсти, обильное шелушение кожи, появление язв на мордочке и животе животного, сильный зуд. Настроение животного нарушено. Оно может прятаться или быть агрессивным.

Эндокринопатии

Подобные заболевания проявляются в виде кожного зуда, появления струпа в области крупа, себореи (сальной кожи). Из-за зуда животное нервничает, активно чешется, на коже появляются ранки и ссадины. Эндокринные заболевания часто приводят к изменению веса животного.

Сальный аденит

Из-за сильного воспаления сальные железы разрушаются, кожа, особенно в зоне хвоста, сильно засаливается, кожа шелушится, шерсть выпадает.

Гиперкератоз

Это симптом дефицита нутриентов, в частности, цинка, либо признак аутоиммунного расстройства. У кошки в области мордочки, на ушах и подушечках пальцев появляются области утолщенной и сильно шелушащейся кожи.

Опухоли

Любые опухоли, но особенно гнездящиеся в органах пищеварения, приводят к исхуданию животного, ухудшению состояния его кожи и шерсти, диспепсии и другим, часто тяжелым для животного проявлениям недуга.

Наследственные патологии

Такой редкий недуг, как гипофизарная карликовость сопровождается истончением кожного покрова и сильным шелушением. При этом взрослые кошки выглядят как молодые незрелые животные.

Это неполный список причин, по которым кожа у животного может шелушиться. Например, иногда кошки заражаются личинками непаразитического червя, обычно проживающего в соломе. В этом случае у них начинается зуд, шелушение, образуются папулки на коже, а затем корки. Поэтому если внимательный владелец заметил это неприятное для кошки явление, стоит отвезти ее в ветлечебницу.

Лечение

Лечение болезни находится в прямой зависимости от причины шелушения. При авитаминозах достаточно ввести в рацион животного рыбий жир, растительные масла (льняное, оливковое), поливитамины.

Несложно исправить ситуацию при воздействии механических и физических факторов на кожу животного. Достаточно создать благоприятный микроклимат в помещении, где содержится животное, приготовить ему мягкую подстилку. Обработать кожу, если домашний любимец подрался.

При инфекционно-паразитарных заболеваниях, внутренних болезнях нужно лечить основное заболевание. В случае аллергий в первую очередь нужно исключить влияние аллергена на организм кота. Это может быть некачественный корм, шампуни или бытовая химия.

Некоторые болезни не поддаются излечению и можно только поддерживать состояние ремиссии с помощью правильной диеты и медикаментов.

Иллюстрации

Отрубевидный Лишай

Шелушение кожи

Трихология

Прием врача-трихолога в Оренбурге

Комплексный прием врача-трихолога — это не только сбор анамнеза какой-либо трихологической проблемы, но еще и диагностика состояния кожи головы и волос на трихоскопе. Трихоскоп — это новейший аппарат, позволяющий увидеть на экране монитора  прикорневую часть волос и кожу, увеличенные многократно. На основе этого метода исследования врач-трихолог максимально точно опишет состояние кожи головы и волос, и на основании детальной картины составит список мер по борьбе за здоровые волосы. В случае назначения процедуры мезотерапии трихолог качественно подберет необходимый препарат или состав мезококтейля. В ситуации андрогинного облысения или иных сложных ситуаций трихолог Медгарда назначит и проведет курсы плазмолифтинга кожи головы.

По результатам комплексного осмотра доктор может посоветовать пациенту также пройти консультацию у других специалистов, чтобы выявить причину трихологических проблем. Это могут быть: иммунолог, гастроэнтеролог, эндокринолог, поскольку проблемы с волосами могут быть вызваны гормональными сбоями или нарушениями обмена веществ.

Профессиональный врач-трихолог клиники Медгард с помощью процедуры мезотерапии дает реальную возможность противостоять патологиям и проявлениям плохого кровоснабжения волосяных луковиц, которые приводят к выпадению волос или облысению

В каких случаях обращаются к трихологу?

  • в случаях андрогинного облысения у мужчин (или у женщин по мужскому типу)
  • после различных заболеваний эндокринной системы (трихолог поможет, только если гормональный фон стал нормальным)
  • после болезни от вируса Covid (после перенесенной коронавирусной инфекции люди часто обращают внимание на обильное выпадение волос)
  • после сильных или продолжительных стрессов
  • при патологической сухости волос, если никакие косметические средства не помогают
  • при патологической перхоти, если никакие фарм-средства не помогают

Как подготовиться к консультации у трихолога?

Прежде всего необходимо приходить к врачу-трихологу не на «кристально чистую» голову. После мытья волос должны пройти минимум одни сутки.


У собаки выпадает шерсть — причины, заболевания, лечение алопеции у собак в Москве. Советы врача. Ветеринарная клиника «Зоостатус»

Симптомы и типы
Причины 
Диагностика 
Лечение 
Содержание и уход 

Выпадение шерсти у собак является распространенным дерматологическим симптомом у собак. Алопеция (очаги облысения) проявляется как полная или частичная потеря волосяного покрова. При проявлении данного симптома можно подозревать, что страдает эндокринная система, лимфатическая система и иммунная система, а также кожа собаки. От облысения могут страдать собаки всех пород, возрастов и пола. Заболевание, приводящее к потере шерсти, может протекать в острой форме либо развиваться постепенно. 

Облысение легко диагностируется по симметричным или случайно расположенным местам без шерсти. Может также проявляться в виде покрытых коркой круглых залысин с воспалением по краям. У некоторых собак возможно шелушение кожи. 

Одна из наиболее распространенных причин облысения — чесотка, которую вызывает клещ Демодекс. Выпадение волос может возникнуть при нарушении роста волосяных фолликулов, что может возникнуть из-за инфекции, травмы, заболевания иммунной или эндокринной системы. Воспаление волосяного фолликула может вызвать появление большого числа залысин. Обильное облысение может указывать на боле специфичную болезнь. 

Структура и степень облысения важны для правильного диагноза и плана лечения. 

  • Множественные области потери волос — часто сопровождаются покраснениями кожи и умеренным шелушением. Грибок, такой как дерматомикоз или бактериальные инфекции, обычно связан с этим типом выпадения волос. Другой частой причиной является склеродермия, кожное заболевание, развивающееся от рубцовой ткани или в результате недавней вакцинации на естественно инъекции. 
  • Симметричная потеря волос — есть несколько известных причин, включая чрезмерный уровень стероидов в организме собаки, низкий уровень гормона щитовидной железы, высокий уровень эстрогена, низкий уровень секреции женского полового гормона и связанную с тестостероном потерю волос. 
  • Очаговое выпадение волос — чесотка (саркоптоз) — одна из самых частых причин этого типа выпадения волос. Другие причины включают бактериальные инфекции и дерматомикоз. Сопровождается покраснениями и воспалениями бесшерстных участков. 

Облысение обычно лечится с шампунями и антибиотиками. В определенных случаях назначают гормональные препараты, если того требует причина заболевания. При наличии опухоли либо кожных образований необходимо хирургическое вмешательство. 

Необходимо строго следовать прописанному лечению. Кроме того, следите за шерстным покровом собаки, чтобы гарантировать отсутствие повторного выпадения шерсти у собаки.

(с) Ветеринарный центр лечения и реабилитации животных «Зоостатус».    
Варшавское шоссе, 125 стр.1. тел. 8 (499) 372-27-37

RACGP — Распространенные высыпания у новорожденных

Общие сведения
Кожа новорожденных уникальна по своей структуре. Дерматологические заболевания у новорожденных обычно доброкачественные и самоограничивающиеся, но они может также предвещать основное системное заболевание и может быть пожизненным угрожающий.

Цель
В данной статье рассматриваются неонатальные дерматозы по различные клинические проявления. Клинические признаки, помогающие выделяют серьезные и доброкачественные состояния, вместе с подходом к начальному управлению распространенные проявления болезни.

Обсуждение
Функционально кожа новорожденных предрасположена к повышенному теплу и потеря жидкости, а также абсорбция лекарств и токсинов. Структурно, его незрелость часто приводит к недооценке, нетипичности и неоднозначные кожные симптомы и признаки. Общие морфологии к кожным заболеваниям новорожденных относятся пустулы; везикулы и буллы; сухая, красная, шелушащаяся кожа; и, реже, экхимозы и корки. Хотя многие распространенные дерматозы являются преходящими реакции на гормональные и экологические факторы, такие как тепло травмы, заражение бактериями, вирусами и грибками может вызвать как заболеваемость, так и смертность.Неопластический, генетический, метаболический и алиментарные заболевания менее распространены, но важны для диагностировать. Клинические и лабораторные данные могут быть ограничены и клинико-патологическая корреляция имеет решающее значение.

Кожа новорожденных обычно мягкая и гладкая, покрыта первородной смазкой, производной сального секрета и разлагающимися клетками эпидермиса. Шелушение обычно происходит с задержкой, от 24 часов до 3 недель, раньше, чем у недоношенных детей. Шелушение в первый день может свидетельствовать о внутриутробной аноксии или нарушении кератинизации (ихтиозе).Цвет обычно быстро становится розовым, за исключением кистей, стоп и губ, где может возникнуть первоначальный темноватый акроцианоз в результате повышенного сосудистого тонуса.

Травма при рождении может привести к образованию дряблой массы кожи головы из-за отека и венозного застоя (caput succadaneum) или поднадкостничной гематомы (цефалогематомы), последняя ограничена одной костью черепа и, возможно, связана с подлежащим переломом, вторичной гипербилирубинемией, кальцификацией и инфекцией . Ятрогенная травма также может вызывать образование рубцов (например,ямки, ямочки), анетодермия (локальная потеря эластической ткани, проявляющаяся в виде мягкого выступа), кровотечение, инфекция, кальцифицированные узелки и аплазия кожи (отсутствие кожи). Другие причины аплазии кожи перечислены в Таблице 1 , и когда они связаны с блестящими «перепончатыми» изменениями или «воротником для волос», могут быть другие дефекты нервной трубки. 3 Детей с аплазией кожи, у которых при рождении локализовано отсутствие интактной кожи, следует направить на обследование к специалисту.

Таблица 1. Причины аплазии кожи
Генетический
  • Буллезный эпидермолиз
  • Синдромы: напр. хромосомные аномалии (Патау, Вольф-Хиршхорн), Деллемана, Финлея-Марка, Гольца, Джонсона-Близзарда, Кабуки, Сетлейса
Развивающая
  • Невусы (эпидермальные)
  • Неврологические пороки развития (напр.энцефалоцеле или миеломенингоцеле)
  • Синдром Адамса-Оливера с аномалиями конечностей
Антенатальное/перинатальное событие
  • Папирусный плод или инфаркт плаценты
  • Травма
Инфекция
  • Токсоплазмоз, краснуха, цитомегаловирус, герпес
Наркотики

Неонатальный цвет

Изменение цвета Арлекина, проявляющееся покраснением нижней половины и бледностью верхней половины у ребенка, лежащего на боку, продолжается несколько минут.Он проявляется в первые 3 недели жизни, обычно на 2-5 дни, в результате незрелости гипоталамуса и чаще встречается при недоношенности и внутричерепных травмах.

Сетчатые (ливедоидные) пурпурные пятна на коже могут свидетельствовать о физиологическом расширении капилляров и вен, усиливающемся на холоде (cutis mamorata), но могут сохраняться патологически (трисомии 18 и 21, Cornelia de Lange). Cutis mamorata telangiectatica congenita представляет собой фиксированное сосудистое изменение, связанное с тонкой кожной атрофией, а иногда и с несоответствием длины конечностей, что может быть частью синдрома.Это может уменьшиться при лечении сосудов лазером.

Неонатальные родимые пятна могут быть легко диагностированы неправильно: гемангиомы могут напоминать пятна портвейна, а ранние врожденные меланоцитарные невусы могут напоминать пятна цвета кофе с молоком. Соответствующее направление и последующее наблюдение имеют решающее значение, поскольку окно возможностей для лечения гемангиом (например, с помощью бета-блокаторов) и гигантских врожденных меланоцитарных невусов (с ранним кюретажем) может быть очень узким. 4,5 Меланоцитарные невусы средних и больших размеров или вовлекающие чувствительные к косметическим средствам области должны быть направлены на лечение к специалисту.Для получения дополнительной информации о родимых пятнах см. статью Райана и Уоррена в этом выпуске австралийского семейного врача . Другие причины изменения цвета кожи перечислены в таблице 2 .

Таблица 2. Причины изменения цвета кожи новорожденных
Цвет Возраст Причины
Желтуха Гемолиз (напр.АВО, резус), инфекции, лекарства
Грудное вскармливание, холестаз, недостаточность ферментов, сепсис, гепатит, лекарства, гипотиреоз, галактоземия
Синдром бронзового ребенка (серо-коричневый цвет) Первая неделя Фототовары для фототерапии
Синдром серого ребенка   Хлорамфеникол
Синдром углеродного ребенка   Универсальный меланоз
Цианоз   Кардио-респираторные заболевания
Бледность   Шок, асфиксия, анемия, отек

Везикулезные и пустулезные высыпания

Хотя наиболее распространенные неонатальные везикуло-пустулезные высыпания являются доброкачественными и самоограничивающимися, необходимо исключить возможные серьезные причины, особенно бактериальные, вирусные и грибковые инфекции (, таблица 3 и 4, рисунок 1 ). 6

Таблица 3. Причины пустулезных высыпаний у новорожденных
Причина Возраст Расследования
Инфекционные
  • Бактериальные: Staphylococcus aureus, Streptococcus pyogenes, Hemophilus influenzae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas, Listeria
  Мазок MCS, системное исследование
  • Сифилис (ладонно-подошвенные изменения)
  Серологическая микроскопия в темном поле, рентген
  • Вирусные: вирус простого герпеса, цитомегаловирус герпеса ветряной оспы, СПИД
  • Грибковые: candida, pityrosporum
  • Паразитические: чесотка
Первые 6 недель Tzanck/IF/PCR/посев, осадок мочи, серология
Мазок MCS
Реактивный
Первые недели Мазок от пятен
  • Транзиторный пустулезный меланоз новорожденных
День 0
День 1–3
  • Эозинофильный фолликулит
Первый год
Первый год
Часов до 6 недель
    • нейтрофилы (+/– эозинофилы
Инфильтрат
  • Гистиоцитоз
  • Недержание пигмента
  Гистология
    • гистиоциты
    • эозинофильный спонгиоз
MCS = микроскопия, посев, чувствительность; IF = иммунофлуоресценция; ПЦР = полимеразная цепная реакция

Рисунок 1.Сгруппированные везикулы и однородные мелкие выдавленные язвы, простой герпес

Токсическая эритема чаще возникает у доношенных повторнобеременных детей. Обычно он возникает в первые 4 дня жизни и исчезает в течение 4 дней. Иногда начало откладывается до 10 дней после рождения или рецидивирует в первые 2–6 недель после рождения. Для него характерны красные пятна и папулы, при этом в трети случаев появляются пустулы. Часто широко распространенный, он напоминает «укусы блох», но щадит ладони и подошвы ног.Фолликулоцентрические субкорнеальные и внутриэпидермальные пустулы содержат эозинофилы и нейтрофилы (окраска по Граму/Райту/Гимзе). Причина неизвестна, и вмешательство показано только для исключения инфекции в атипичных случаях. Транзиторный неонатальный пустулез, возможно, является вариантом токсической эритемы, которая чаще наблюдается у темнокожих детей. Он часто возникает в первый день жизни и поражает лоб, подбородок, шею, нижнюю часть спины, ягодицы и голени. Пустулы, напротив, лишены окружающей эритемы и оставляют пигментированные пятна с тонким белым воротничком из чешуек, которые могут сохраняться в течение многих недель.

Таблица 4. Причины везикулярных высыпаний у новорожденных
Причина Расследования
Инфекционные
Мазок Цанка, гистология крыши волдыря, микроскопия, посев, чувствительность (MCS)
Серологическая микроскопия в темном поле
Рентген
Мазок Цанка, полимеразная цепная реакция, иммунофлуоресценция
Культура MCS
Инфильтрат
  • Лангергансоклеточный гистиоцитоз
  • Буллезный мастоцитоз (рис. 8)
Гистология
Плюс Гимза/толуидиновый синий
Иммуноопосредованные
  • Герпетиформный дерматит
  • Приобретенный буллезный эпидермолиз
  • Буллезная системная красная волчанка
  • Линейный IgA буллезный дерматоз
  • Буллезный пемфигоид
  • Герпес беременных
  • Вульгарная пузырчатка
Гистология
Плюс прямая и непрямая иммунофлуоресценция
Жестокое обращение с детьми
Токсический эпидермальный некролиз
Наследственный
  • Буллезный эпидермолиз
  • Недержание пигмента
  • Синдром Гольца
  • Порфирия
Гистология
Плюс электронная микроскопия, иммунофлуоресцентное картирование, генетическое тестирование

Закупорка потовых протоков вызывает потницу ( Рисунок 2 ), которая обычно поверхностна (кристаллическая потница) и поражает лоб; он очищается примерно через 2 дня.На 10-й день у некоторых новорожденных могут появиться более глубокие красные папулы (miliaria rubra), которые развиваются на шее и туловище, которые могут сопровождаться пустулами (miliaria pustulosa). Может быть вторичная бактериальная инфекция (стафилогенный перипорит), поэтому может быть рекомендован мягкий антисептик, такой как 0,1% водный раствор хлоргексидина; предотвращение перегрева и окклюзии имеет первостепенное значение.

Рисунок 2. Милиария, связанная с легкими угревыми изменениями


Рисунок 3. Pityrosporum фолликулит у здорового новорожденного

Неонатальный пустулез головного мозга является формой фолликулита pityrosporum (malessezia) ( Рисунок 3 ).Стойкие папулопустулы обнаруживаются на подбородке, щеках и лбу. Дрожжи pityrosporum могут быть связаны с себорейным дерматитом и отрубевидным лишаем. Он может стимулировать закупорку фолликулов, напоминающую акне, у детей. 7 При пустулезе головного мозга новорожденных быстро реагируют на местные противогрибковые препараты, но их не следует использовать неосмотрительно в первые несколько недель жизни, учитывая повышенный риск абсорбции и токсичности для новорожденных. Курсы, применяемые по неотложным социальным причинам в конце первого месяца жизни, должны быть щадящими и, как правило, продолжительностью всего несколько дней.Пустулы Pityrosporum также могут проявляться клинически нефолликулярно. 8 Детские угри ( Рисунок 4 ), возможно связанные с материнскими андрогенными гормонами, могут проявляться в неонатальном периоде или в более позднем младенчестве с комедонами и папулопустулами. Тяжелые или персистирующие узловато-кистозные узлы могут потребовать специализированной терапии и обследования на предмет гиперандрогении.

Рисунок 4. Детские акне с комедонами, папулами, пустулами и кистами

Неонатальный эозинофильный фолликулит, который отличается от взрослых форм и форм, связанных с ВИЧ, может быть проявлением гипериммуноглобулинемии.Наблюдается в основном на голове и шее, может сохраняться и рецидивировать, но идиопатические случаи обычно исчезают к 3 годам. Детям старшего возраста может помочь местное применение стероидов, режим антигистаминных препаратов и иногда дапсон, но они не подходят в раннем возрасте.

Чесотка у новорожденных может быть обширной и без явного зуда.

Изменения могут быть заметными на акрах и гениталиях, подобно чесотке у детей старшего возраста, но могут также быть более распространенными и вовлекать скальп и лицо, с везикулами, пустулами, бородавками, экземой и вторичной импетигинизацией.Для лечения можно использовать как 5% перметрин (8 часов на ночь), так и 5% раствор серы в парафине (дважды в день в течение 1 недели). Акропустулез ( Рисунок 5 ) – это состояние, которое, как считается, следует за чесоткой, с рецидивирующим образованием зудящих везикулопустул на ладонях, подошвах и тыльной стороне акральной кожи. Он реагирует на местные стероиды и обычно проходит к 2-летнему возрасту. Назначение дапсона редко оправдано.

Рисунок 5. Акропустулез с рассасывающимися папулами и пустулами

Линейно расположенные везикулопустулы, особенно на конечностях и туловище, могут быть следствием недержания пигмента ( Рисунок 6 ).Это сцепленное с Х-хромосомой доминантное состояние, которое обычно поражает женщин, может быть связано с алопецией, глазными, стоматологическими и нервно-психическими осложнениями. Другие изменения кожи включают линейную и мутовчатую пигментацию, бородавчатые бляшки и линейные атрофические области, которые могут следовать линиям развития (блашкоидным).

Рисунок 6. Линейные папулы и пустулы при пигментной недержании мочи 1 стадии

Милиумы могут быть неправильно диагностированы как пустулы, но на самом деле представляют собой твердые кератиновые кисты размером 1–2 мм, часто скопившиеся на лбу, носу, щеках и подбородке.Обычно они спонтанно разрешаются к 3-4-недельному возрасту. Если они широко распространены и персистируют, они могут указывать на основной синдром, такой как триходисплазия или буллезный эпидермолиз.

Буллезный эпидермолиз ( Рисунок 7 ) представляет собой механобуллезное заболевание, связанное с различными генетическими мутациями белков кожи и характеризующееся хрупкостью кожи, волдырями и язвами. Относительно незначительная травма приводит к образованию пузырей и эрозий. Степень поражения слизистых оболочек, ногтей, зубов и системных заболеваний (таких как стеноз пищевода, заболевания глаз, кишечника, сердца и почек) зависит от подтипа, узловая и дермолитическая формы являются более тяжелыми и иногда летальными.Дети с клинически значимым механобуллезным заболеванием должны быть обследованы специалистом, обладающим опытом в этой области, поскольку существует множество современных разработок как в диагностических тестах, так и в доступных методах лечения. В Новом Южном Уэльсе, Квинсленде и Виктории в настоящее время назначаются специальные медсестры, работающие с детскими дерматологами и Национальной ассоциацией исследований дистрофического буллезного эпидермолиза Австралии (DebRA), для быстрой диагностики и лечения этих пациентов.

Рисунок 7. Пузыри и язвы рецессивного дистрофического буллезного эпидермолиза

Экхимозы и корки

Аналогичные инфекционные, травматические и генетические причины следует учитывать у новорожденных с экхимозами и корками. Коагулопатии (дефицит протеина C или S, фибриногена или вторичный дефицит вследствие инфекции или материнских антител), неонатальная болезнь Бехчета, неонатальная волчанка и изъязвленные опухоли. 9 Волчанка новорожденных обычно проявляется красными кольцевидными пятнами и бляшками у новорожденных, часто на лице.Что касается материнских антител к Ro и La, важно выбрать их из-за риска ассоциированной блокады сердца.

Неонатальные папулы и узелки

Узелки по средней линии могут свидетельствовать о дизэмброгенезе, и его необходимо исключить перед любым вмешательством. К патологиям относятся:

  • голова: менингоэнцефалит, дермоидные кисты, глиома носа
  • шея: щитовидно-язычная киста, жаберные кисты
  • шея и спина: менингоцеле и спинальная дизрафия
  • пупок: омфаломезентериальная дизрафия. 10

Рассеянные голубоватые узелки и папулы наблюдаются у «черничного маффина ребенка» и могут свидетельствовать об основной опухоли (например, нейробластоме, рабдомиосаркоме, лейкемии), инфекции (токсоплазмозе, краснухе, цитомегаловирусе, Коксаки В2, парвовирусе В19, сифилисе) и другой экстрамедуллярный эритропоэз (наследственный и иммунный гемолиз).

Другие кожные клинические признаки при диагностике узелков и бляшек включают симптом Дарье (крапивница или волдыри с растиранием, наиболее часто наблюдаемые при мастоцитозе, рис. 8 ), оранжевый цвет (инфантильная ксантогранулема, рис. 9 ), красно-синий цвет с периферическими сосудами и устойчивые результаты допплерографии (гемангиома), подкожное воспаление (некроз подкожной жировой клетчатки), глубокое расположение и плотная текстура (фиброматоз, мифиброматоз, склерема новорожденных), пурпура и изменения, подобные себорейному дерматиту (гистиоцитоз).Клинические признаки и результаты визуализации могут быть ошибочными, и может потребоваться диагностика тканей. Также необходимо выявить возможные осложнения (например, гиперкальциемия при жировом некрозе, системное заболевание).

Рисунок 8. Уртикативные и пузырчатые папулы и бляшки при пигментной крапивнице (форма мастоцитоза)


Рисунок 9. Детская ксантогранулема

Молочница и красная чешуйчатая сыпь

Колпачок колыбели происходит на ранней стадии из первородной смазки, а впоследствии, возможно, также из сальных выделений.Малессия также может способствовать возникновению колыбельной шапочки. Как правило, он проходит сам по себе, но применение мягкого детского шампуня или минерального масла (жидкого парафина) может помочь его смягчить. При более обширном себорейном дерматите (сальные, незудящие, эритематозные изменения лица, ушей, шеи, области под подгузником) роль щадящего местного применения гидрокортизона и имидазолового крема ограничена.

Себорейный дерматит обычно возникает через 1 месяц, а атопический дерматит — через 2–3 месяца. Первые обычно не зудят, в то время как вторые часто характеризуются значительным зудом.

Врожденное распространенное шелушение с покраснением или без него (эритродермия) повышает вероятность ихтиоза (например, синдром Нетертона, Шегрена-Ларссена) и иммунодефицита (например, синдром Оменна). 11 Однако к причинам эритродермии в первый месяц жизни следует дополнительно отнести псориаз, красный волосяной лишай, нарушения обмена веществ (дефицит цинка, белковая недостаточность, множественный дефицит карбоксилаз, нарушения цикла мочевины, дефицит незаменимых жирных кислот и биотина), обожженную кожу синдром, кандидоз и наркотики. 12 Дефицит цинка вызывает четко очерченные псориазоподобные бляшки на руках, ногах, промежности, плечах, периоральные трещины, истончение волос и раздражительность. Обычно это происходит из-за недостаточного потребления цинка, но иногда может быть результатом мальабсорбции. Измерение уровня цинка может быть ненадежным, но изменения кожи быстро исчезают при возмещении цинка.

Детский коллодий относится к младенцам, заключенным в плотную желтую блестящую пленку при рождении. Хотя обычно он возникает в результате ламеллярного ихтиоза и небуллезной врожденной эритродермии, он может быть связан с другими синдромами ихтиоза, такими как трихотиодистрофия и, возможно, нарушение обмена веществ (тип Гоше 2, гипотиреоз).Термический и жидкостный дисбаланс, инфекция, нарушение дыхания, эктропион, проблемы с кормлением и стягивающие полосы — все это возможные осложнения. Следовательно, неонатальная интенсивная и междисциплинарная помощь требуется для большинства случаев коллодия ребенка. Врожденная эритродермия и коллодиоз у детей требуют специализированной помощи.

Ключевые точки

  • Сведите к минимуму использование местных токсинов и ненужных лекарств у новорожденных.
  • Рассмотрите бактериальные, вирусные и грибковые инфекции у новорожденных с пустулезными и везикулобуллезными дерматозами.
  • Простые тесты, такие как мазки и посев жидкости, могут быть очень полезными.
  • Узелки, синяки и корочки могут указывать на серьезное основное заболевание.
  • Срединные дефекты могут быть связаны с аномалиями нервной трубки.
  • Раннее шелушение и эритродермия могут свидетельствовать о генетических заболеваниях, таких как ихтиоз и первичный иммунодефицит.

Конфликт интересов: не заявлен.

Ссылки

Запись ОМИМ — № 609796

Знак номера (#) используется с этой записью из-за доказательств того, что синдром шелушения кожи-2 (PSS2), акральная форма заболевания, вызывается гомозиготной или сложной гетерозиготной мутацией в гене TGM5 (603805) на хромосоме 15q15. .

Синдром шелушения кожи (ПСС) представляет собой аутосомно-рецессивный генодерматоз, характеризующийся отслоением наружного эпидермиса. При акральной форме заболевания (PSS2) преимущественно поражаются тыльные поверхности кистей и стоп, а ультраструктурный анализ показывает разделение в месте соединения зернистых клеток и рогового слоя в наружном эпидермисе (резюме Cassidy et al., 2005).

Для обсуждения генетической гетерогенности синдрома шелушения кожи см. PSS1 (270300).

Кэссиди и др. (2005) описали 2 семьи, 1 голландскую и 1 шотландскую, с невоспалительным синдромом акрального шелушения кожи, в котором шелушение сопровождалось эритемой. У больных наблюдалось периодическое, безболезненное и поверхностное шелушение кожи. Хотя шелушение кожи происходило спонтанно, ручное удаление полосок кожи было легким. Аномалия усугублялась повышенной температурой и влажностью окружающей среды.На отслоившихся участках наблюдалась некоторая остаточная эритема в течение нескольких дней, но они заживали спонтанно и без рубцов. Гистологический и ультраструктурный анализ случаев синдрома шелушения кожи показал, что уровень образования пузырей высок в эпидермисе, на стыке зернистого слоя (последний живой слой) и рогового слоя (терминально дифференцированный и постоянно отслаивающийся, ороговевающий сквамозный слой). слои). Таким образом, заболевание гистологически отличается от различных форм буллезного эпидермолиза, при которых образование пузырей происходит в базальных кератиноцитах эпидермиса, внутри или вблизи дермально-эпидермальной базальной мембраны или в верхних слоях сосочковой дермы.Голландская семья включала 5 пораженных особей в 2 межпородных сибшипах. Генеалогический анализ установил кровное родство, датируемое 1780-ми годами. Родственное родство в шотландской семье установить не удалось.

Швейдер и др. (1997) и Hashimoto et al. (2000) описали семьи с акральным ПСШ.

Харфи и др. (2009) сообщили о 2 тунисских братьях в возрасте 5 и 3 лет с очаговым шелушением кожи рук и ног. Шелушение произошло спонтанно, и листы кожи можно было безболезненно снять; нижележащие эритематозные участки зажили без рубцов в течение нескольких дней.Симптомы ухудшались при повышенной температуре окружающей среды, влажности и трении. Поражаются только ладонно-подошвенные области и тыльная поверхность кистей и стоп. Семейный анамнез включал еще 3 больных, но они не были доступны для изучения. При гистологическом исследовании границы ладонного поражения выявлено утолщение рогового слоя с расщеплением в светлой зоне; при ультраструктурном исследовании в роговом слое выявлены расширенные межклеточные пространства, в зернистых клетках — звездчатые и электронно-плотные гранулы кератогиалина разного размера.Десмосомных аномалий не наблюдалось, в межклеточных пространствах между корнеоцитами происходило дробление.

Кирици и др. (2010) изучали 6 неродственных детей и 1 взрослого пациента из Германии, 1 ребенка из Швеции и 1 ребенка из Финляндии, у которых был клинически диагностирован простой буллезный эпидермолиз (см. 131800). У больных отмечались волдыри и шелушение акральной кожи; заживление происходило спонтанно, иногда с остаточной эритемой, ощущением жжения или зуда, но без рубцевания или атрофии.Потоотделение, жара, влажность или механическая травма усугубляют симптомы. В большинстве случаев поражались только ладонные и тыльные поверхности кистей и стоп, но у больного 47 лет также отмечалось отслоение локтей и коленей. У детей старшего возраста и взрослых пациентов наиболее заметным симптомом было шелушение кожи, но иногда появлялись волдыри. Двое из детей сообщили, что родитель имел легкое заболевание, а у взрослого пациента, как сообщается, был ребенок с легкими признаками заболевания.Образцы кожи некоторых пациентов показали дискретное расщепление рогового слоя, наводящее на мысль о акральном ПСШ.

Путем полногеномного анализа сцепления у кровнородственного голландского родственника Cassidy et al. (2005) картировали ген акральной формы синдрома шелушения кожи на хромосоме 15q15.2 в интервале между маркерами D15S1040 и D15S1016.

У всех пораженных представителей голландских и шотландских родственников с акральным ПСШ Cassidy et al.(2005) идентифицировали гомозиготность по миссенс-мутации в гене TGM5 (G113C; 603805.0001), которая полностью устраняла активность сшивания. Другой гомозиготный миссенс-вариант TGM5, присутствующий у пораженных людей, T109M, не приводил к значительному снижению активности TGM5 и считался редким полиморфизмом. Мутация присутствовала в одном и том же гаплотипе в 2 родах, что указывает на возможную наследственную мутацию. В других семьях с более распространенным фенотипом шелушения кожи, подобным описанному в PSS (270300), мутации TGM5 отсутствовали.

У 2 тунисских братьев с АПСС, Kharfi et al. (2009) секвенировали ген TGM5 и определили гомозиготность по миссенс-мутации (K445N; 603805.0002), которая присутствовала в гетерозиготности у их здоровых двоюродных родителей. Мутация не была обнаружена у 120 контролей из Северной Африки.

У 6 неродственных детей и 1 взрослого пациента из Германии, 1 ребенка из Швеции и 1 ребенка из Финляндии с образованием пузырей и шелушением акральной кожи, первоначально диагностированным как простой буллезный эпидермолиз, и у которых не было мутаций в KRT5 (148040) и KRT14. (148066), Kiritsi et al.(2010) идентифицировали гомозиготные или сложные гетерозиготные мутации в гене TGM5 (603805.0001; 603805.0003). Кирици и др. (2010) пришли к выводу, что APSS может напоминать EBS у молодых людей. Авторы также отметили, что в 3 семьях рассматривалась вертикальная передача заболевания, поскольку сообщалось, что либо у родителей, либо у потомства в детстве были кожные волдыри; однако о клиническом обследовании предполагаемых пораженных гетерозигот не сообщалось.

У 6 пациентов из 6 неродственных семей с APSS van der Velden et al.(2012) определили гомозиготность по мутации G113C в гене TGM5, а также гомозиготность по полиморфизму T109M. Все пациенты сообщали об шелушении или волдырях на руках и ногах с младенческого возраста, при этом симптомы усиливались от тепла, влажности или трения. Генеалогическое исследование, датируемое 1650 годом, не выявило кровного родства между семьями. Анализ гаплотипов этих 6 семей, в том числе 5 из Нидерландов и 1 из Германии, а также 2 голландских и шотландских семей, ранее изученных Cassidy et al.(2005) показали, что все носители мутаций были гомозиготными по области приблизительно 0,16 млн п.н., которая начинается центромерно и включает ген TGM5. Ван дер Вельден и др. (2012) отметили, что в отличие от 2 тунисских пациентов, о которых сообщили Kharfi et al. (2009), все 21 зарегистрированный европейский пациент с APSS несли мутацию G113C, связанную с вариантом T109M, что позволяет предположить наследственную мутацию основателя в европейской популяции.

У 11 пациентов с АПСС Pigors et al. (2012) определили гомозиготность или компаундную гетерозиготность по мутациям в гене TGM5 (см., например,г., 603805.0001 и 603805.0004-603805.0006). Кроме того, рекуррентная мутация G113C была обнаружена в гетерозиготном состоянии у 3 из 100 контролей, что позволяет предположить, что APSS может быть более распространенным, чем предполагалось, при этом легкий фенотип остается либо недиагностированным, либо неправильно диагностированным.

Что объясняет аномалии кожи и волос у этого ребенка?

Атопический дерматит может быть неправильно диагностирован как синдром Нетертона из-за наличия экзематозных поражений и личного или семейного анамнеза атопии при синдроме Нетертона.Однако при атопическом дерматите врожденная ихтиозиформная эритродермия/линейный ихтиоз огибающей и инвагинальный трихорексис отсутствуют.

Псориаз характеризуется резко отграниченными, эритематозными, круглыми или овальными бляшками с рыхло прикрепленными серебристо-белыми слюдяными чешуйками. 26 Удаление чешуек приводит к мелкоточечному кровотечению (симптом Ауспитца). 26 Поражения обычно симметрично распределены и сопровождаются зудом. На месте травмы могут образоваться новые поражения (феномен Кебнера). 26 У большинства пациентов в конечном итоге развивается поражение ногтей, которое включает изъязвление, обесцвечивание, онихолизис или ониходистрофию. 26 Врожденный псориаз и синдром Нетертона также могут проявляться неонатальной эритродермией и шелушением с перекрывающимися признаками рецидивирующих кожных инфекций и задержкой развития. 6 Описаны случаи синдрома Нетертона, имитирующего псориаз. 6,12 При синдроме Нетертона симптом Ауспитца и феномен Кебнера отрицательны, поражение ногтей не характерно.С другой стороны, у пациентов с псориазом нет invaginata trichorrhexis и атопического диатеза, наблюдаемых у пациентов с синдромом Нетертона.

Себорейный дерматит — распространенное хроническое воспалительное заболевание кожи, характеризующееся эритемой и сальными чешуйками, поражающими участки, богатые сальными железами. 27 У младенцев с себорейным дерматитом часто обнаруживают очаговое или диффузное шелушение и корки на коже головы. Эритематозные или лососевого цвета четко очерченные пятна с желто-белыми чешуйками могут поражать лицо, заушные области, туловище, а также интертригинозные и сгибательные области тела. 27 В области подгузника детский себорейный дерматит проявляется в виде четко очерченных эритематозных чешуйчатых высыпаний с тенденцией к слиянию, что приводит к образованию крупного сливного очага. Характерно отсутствие зуда. При себорейном дерматите шелушение обычно более жирное, а места локализации отличаются от таковых при синдроме Нетертона. 8 Отсутствие invaginata trichorrhexis и атопического диатеза подтверждает диагноз себорейного дерматита.

Энтеропатический акродерматит, вызванный наследственным или приобретенным дефицитом цинка, характеризуется акральным и периоритериальным дерматитом, диареей, задержкой развития и алопецией. 28 Классически кожные поражения представляют собой симметричные, четко очерченные, эритематозные, шелушащиеся, покрытые корками и различной степени эрозии бляшки. Высыпания могут быть экзематозными, псориазоподобными и, реже, везикулобуллезными. Кожная сыпь, диарея и задержка развития могут имитировать признаки синдрома Нетертона.У больных энтеропатическим акродерматитом инвагинальный трихорексис отсутствует, а частота атопического диатеза не повышена.

Синдром шелушения кожи представляет собой гетерогенную группу аутосомно-рецессивных заболеваний, характеризующихся поверхностным безболезненным шелушением кожи с образованием пузырей без вовлечения слизистой оболочки. Выделяют две основные формы синдрома шелушения кожи, а именно синдром акрального шелушения кожи и синдром генерализованного шелушения кожи. Последний подразделяется на генерализованный невоспалительный (тип А) синдром шелушения кожи и генерализованный (тип В) воспалительный синдром шелушения кожи.Пациенты с генерализованным синдромом воспалительного шелушения кожи (тип В) обычно имеют при рождении ихтиозиформную эритродермию, поверхностное шелушение кожи, сильный зуд, пищевую аллергию, крапивницу, ангионевротический отек, астму, рецидивирующие кожные инфекции и задержку развития. 8 Эти признаки также часто наблюдаются у пациентов с синдромом Нетертона. Отсутствие аномалии волосяного стержня свидетельствует в пользу диагноза генерализованного (тип В) синдрома воспалительного шелушения кожи.

Синдром

SAM представляет собой аутосомно-рецессивный наследственный генодерматоз, вызванный гомозиготными мутациями в гене десмоглеина 1 ( DSG1 ). 29,30 Синдром характеризуется врожденной эритродермией, шелушением, тяжелым дерматитом, ладонно-подошвенной кератодермией, эрозиями кожи, множественными пищевыми аллергиями, повышенным уровнем IgE, рецидивирующими инфекциями, нарушением всасывания, метаболическим истощением и задержкой развития. 29,30 У пораженных пациентов жесткие вьющиеся волосы, но не инвагинальный трихорексис, что помогает отличить это состояние от синдрома Нетертона.

Дерматология у собак и кошек

1. Введение

Кожа является самым большим органом тела с множеством различных функций, таких как терморегуляция, иммунная защита, сенсорное восприятие, выработка витамина D, и она действует как барьер между животным и окружающей средой. .Помимо всех этих важных функций и заболеваний, поражающих непосредственно кожу, она также может разделять или отражать патологические процессы из других тканей. Из-за этих характеристик дерматологические проблемы являются одними из наиболее часто встречающихся заболеваний в ветеринарных клиниках. Для ветеринара важно знать и понимать физиологию кожи и наиболее распространенные дерматологические заболевания, поражающие собак и кошек, которые будут рассмотрены в этой главе.

Реклама

2.Строение кожи

Кожа делится на три слоя: эпидермис, дерма и гиподерма (рис. 1). Эпидермис, самый наружный слой кожи, состоит из кератиноцитов, меланоцитов и клеток Лангерганса. Кератиноциты также располагаются слоями в эпидермисе. Самый глубокий из них, базальный слой, образован одним рядом герминативных кератиноцитов и также содержит меланоциты. Эти зародышевые кератиноциты генерируют другие слои путем деления и дифференцировки клеток. Следующий слой, шиповатый, отличается от базального наличием межклеточных контактов.Клетки Лангерганса также присутствуют в этом слое. Гранулезный слой характеризуется большим количеством кератогиалиновых гранул внутри кератиноцитов, которые играют важную роль в процессе ороговения кожи. Роговой слой, наружный слой эпидермиса, состоит из кератиноцитов в максимальной степени дифференцировки (корнеоцитов), вкрапленных в липидный матрикс [1].

Дерма, слой под эпидермисом, состоит из конъюнктивного матрикса, в котором находятся ретикулярные, эластические и коллагеновые волокна.Клеточная структура дермы состоит из фибробластов, тучных клеток и гистиоцитов. Он также содержит эпидермальные придатки (волосы, ногти, сальные и потовые железы), мышцы, выпрямляющие волосы, и кровеносные и лимфатические сосуды. Гиподерма или подкожная ткань обеспечивает поддержку и амортизацию при физических травмах. Он состоит из рыхлой соединительной ткани и эластических волокон с вкраплениями адипоцитов [1]. Волосяные фолликулы демонстрируют циклы активности, которые приводят к образованию волос. Анаген – это период активного роста, когда формируются новые волосы.Катаген – это когда прекращается рост волос и происходят дегенеративные изменения в основании фолликула. Телоген представляет собой период бездействия фолликулов, когда волосы выпадают, чтобы новые могли начать расти [1]. Активность цикла шерсти у некоторых пород собак тесно связана с колебаниями температуры и фотопериодом, что приводит к снижению густоты шерсти в теплые месяцы, что способствует потере тепла у этих животных [2].

Рисунок 1.

Структура кожи.

Реклама

3.Методы диагностики

Подход к диагностике кожных заболеваний зависит от сбора подробного анамнеза с тщательным физикальным и дерматологическим обследованием. Оценка предлагает ценную информацию и направляет процесс расследования. Следует проводить специальные тесты и, иногда, терапевтические испытания [3].

Соскобы кожи, трихограмма, грибковые и бактериальные культуры, цитологическое исследование и биопсия кожи являются важными методами диагностики в дерматологии. Соскобы кожи применяются для обнаружения клещей, и они могут быть поверхностными или глубокими, в зависимости от подозреваемого клеща.Полученный образец оценивают под оптической микроскопией [3]. Посев на грибы рекомендуется пациентам с подозрением на грибковые заболевания. Образцы волос и кожных чешуек следует брать с края поражения. Бактериальный посев проводят нечасто и рекомендуют его при пиодермии, рефрактерной к начальной терапии, или при обнаружении палочек в цитологии [4]. Непосредственное исследование волос, трихограмма, выполняется путем выдергивания волос из пораженного участка с последующей микроскопической оценкой.С помощью этой методики можно определить нарушения фаз роста волос, наличие фолликулярных паразитов и дерматофитов [3]. Цитология — это анализ клеток ткани, и это очень эффективное и ценное исследование для оценки поражения, после которого можно определить следующий шаг в диагностическом подходе. Образец может быть получен путем тонкоигольной аспирации, мазка, соскоба кожи или отпечатка поражения [5]. Гистопатология, связанная с клиническими данными, обычно приводит к окончательному диагнозу.Биопсия кожи рекомендуется при необычных поражениях, возможно неопластических узелках, дерматозах с дорогостоящей терапией или когда она представляет риск для здоровья пациента, при плохом ответе на предшествующую терапию и для исключения дифференциальных диагнозов [4]. Для проведения гистопатологического исследования необходимо получить не менее трех репрезентативных образцов путем пункции или хирургической резекции [3].

Реклама

4. Бактериальные кожные заболевания

Пиодермия — бактериальная кожная инфекция, которая является одной из наиболее частых причин кожных заболеваний у собак [6], однако реже встречается у кошек [7].Поражения могут быть поверхностными и вовлекать только эпидермис, или они могут затрагивать более глубокие структуры в дерме или подкожной клетчатке, и поэтому пиодермию делят на поверхностную, поверхностную и глубокую [6]. Staphylococcus pseudintermedius — наиболее часто выделяемая из кожи собак бактерия [8], и это одна из основных причин применения противомикробных препаратов у этих животных [9].

Поверхностные пиодермии характеризуются поверхностными эрозиями рогового слоя. Наличие алопеции, эритемы и зуда являются частыми находками [10].Интертриго представляет собой поверхностную пиодермию, поражающую кожные складки на губах, морде, вульве, хвосте и молочных железах у некоторых пород, а также может поражать кожные складки у тучных животных. Острый влажный дерматит, также известный как пиотравматический дерматит или горячие точки, имеет острое начало и редко возникает как первичное заболевание здоровой кожи, обычно будучи вторичным по отношению к другим заболеваниям [11]. Вероятно, местное раздражение, обусловленное первопричиной, приводит к самоповреждению, которое быстро переходит в обширные участки поражения кожи [10].

Поверхностные пиодермии являются наиболее распространенными причинами кожных бактериальных инфекций у собак [6]. Они поражают поверхностную часть волосяных фолликулов (бактериальный фолликулит) или эпидермис (импетиго), вызывая пустулы [10, 11]. Наиболее распространенными поражениями являются покрытые коркой папулы из-за преходящего характера собачьих пустул. Зуд, эпидермальные воротнички, гиперпигментация и алопеция также являются частыми находками [6]. Импетиго поражает неполовозрелых собак, которые могут иметь подкорнеальные пустулы, образующиеся в паховой и подмышечной областях [10].Поверхностный бактериальный фолликулит является наиболее распространенной формой пиодермии у собак [12]. Обычно встречаются папулы, пустулы, связанные с волосяными фолликулами, эпидермальные воротнички, алопеция и гиперпигментация [10] (рис. 2).

Глубокая пиодермия не возникает спонтанно, часто начинается как поверхностная пиодермия [6]. Другие организмы, такие как Proteus spp., Pseudomonas spp. и E. coli могут быть вовлечены [12-14]. Бактериальная инфекция поражает самую глубокую часть волосяного фолликула (глубокий фолликулит), что может привести к разрыву стенки фолликула и высвобождению бактериальных продуктов в дерму (фурункулез), или может также поражать более глубокие части дермы и подкожной клетчатки. целлюлит) [10, 15].Пораженная кожа эритематозная, гиперпигментированная, с наличием серозно-гнойного детрита из вскрывшихся пустул; также отмечают переменный зуд, отек, жесткость кожи и выраженную боль [6].

Диагноз ставится на основании оценки клинических признаков, наличия характерных поражений кожи, исключения других возможных причин фолликулита и цитологической оценки содержимого интактных пустул, экссудативных поражений и остатков кожи. При лечении пиодермии важно определить возможное основное заболевание, что может быть сделано с помощью соскобов кожи, терапевтических проб против чесотки, тестов на аллергию, скрининга на эндокринопатии, испытаний гипоаллергенной диеты, строгого контроля эктопаразитов и биопсии кожи.[16].

Лечение зависит от представленных поражений. Локальные поверхностные и поверхностные пиодермии можно лечить только местными антибиотиками, такими как сульфадиазин серебра, неомициновая или 2% мупироциновая мази, наносимые два раза в день на пораженные участки. Генерализованные поражения и глубокие пиодермии требуют комбинации пероральных и местных антибиотиков. У пациентов с выраженным зудом рекомендуется применять противовоспалительные дозы преднизолона перорально до двух недель [17]. Антибиотики выбора для перорального применения включают цефалексин (22–33 мг/кг каждые 12 ч) и амоксициллин, связанный с клавулановой кислотой (22 мг/кг каждые 12 ч) [18].Повторяющиеся случаи требуют посева и тестирования на чувствительность к доступу к резистентности [16].

Рисунок 2.

Поверхностный бактериальный фолликулит у таксы. В области туловища видны множественные участки алопеции и эритемы.

Реклама

5. Грибковые заболевания

5.1. Дерматофития

Дерматофития представляет собой поверхностный микоз, вызываемый грибами родов Microsporum , Trichophyton или Epidermophyton . Эти грибы выделяют из волос, ногтей и поверхности кожи, поскольку для их роста требуется кератин [19].Дерматофиты делятся на три группы в зависимости от их среды обитания: зоофильные, в основном встречаются у животных, происходит передача другим животным или человеку; антропофильные, в основном встречающиеся у человека, передающиеся от человека к животным и редко – геофильные, дерматофиты, встречающиеся в почве, поражающие людей и животных [20]. M. canis — наиболее часто выделяемый вид грибов у собак и кошек [21].

Клинически грибковые инфекции собак и кошек различаются. Инфекции у собак часто вызывают поражения, в то время как от клинически здоровых кошек можно выделить дерматофиты, которые могут выступать в качестве резервуара конидий гриба [22].Пораженные животные обычно имеют алопецию, чешуйки, корочки, эритематозные и папулезные поражения, особенно на морде и конечностях. Иногда дерматофиты могут быть представлены в узловатой форме, известной как керионы. Эта форма дерматофитии характеризуется глубокими воспалительно-гнойными поражениями [23]. Зуд может варьироваться от отсутствующего до сильного [24].

Прямое микроскопическое исследование волосков и чешуек может выявить наличие грибковых гиф или спор. Грибковая культура является предпочтительным диагностическим тестом, и образец можно получить, почистив животное зубной щеткой или соскобом кожи [25].

Наилучшей стратегией лечения дерматофитов является сочетание системной и местной противогрибковой терапии. Целью лечения препаратами для местного применения является устранение грибков, присутствующих на эпидермисе и поверхности волос, в то время как системное лечение направлено на устранение инфекции внутри волосяных стержней [26]. Полоскание известково-серным раствором 6,5 % два раза в неделю показало хорошие результаты у кошек, инфицированных M. canis [27, 28]. Варианты системного лечения включают итраконазол перорально в дозе 10 мг/кг 1 раз в сутки, гризеофульвин 50 мг/кг 1 раз в сутки или тербинафин 5 мг/кг 1 раз в сутки [27-29].Лечение должно быть продлено на 2-4 недели после клинического излечения и после получения двух или более отрицательных грибковых культур [23].

5.2.

Malassezia дерматит

Malassezia pachydermatis представляет собой комменсальный кожный дрожжевой грибок, обычно выделяемый из губ, межпальцевой кожи, слизистой оболочки заднего прохода и наружного слухового прохода [30]. Это условно-патогенные дрожжи, которые обычно проявляются после установки других заболеваний. Это очень часто встречается у собак и реже всего у кошек [31].Предшествующая антибактериальная терапия связана с развитием кожного M. pachydermatis избыточного роста у собак [32], а также нарушениями ороговения и гиперчувствительными заболеваниями [33]. Более предрасположены к этому типу инфекции бассет-хаунды, кокер-спаниели и вест-хайленд-уайт-терьеры [32].

Наиболее частым клиническим проявлением дерматита, вызванного Malassezia , является наличие зуда от умеренного до интенсивного [34]. Эритема, лихенификация, жирная кожа, неприятный запах, алопеция и эрозии также являются частыми клиническими проявлениями [35], которые могут быть генерализованными или локализованными [34].

Цитология является предпочтительным методом диагностики и позволяет микроскопически идентифицировать повышенное количество дрожжей. Образцы можно получить с помощью соскобов кожи, мазков, прямого отпечатка или с помощью липкой ленты. Культура грибов не рекомендуется в качестве диагностической процедуры, поскольку она не является количественной оценкой [36].

Выявление и коррекция предрасполагающих заболеваний необходимы для успешного лечения Malassezia дерматита [23]. Легкие случаи можно лечить шампунями с миконазолом, хлоргексидином, кетоконазолом или уксусной кислотой.Ванны следует принимать два раза в неделю в течение как минимум шести недель [36]. Пациенты, нуждающиеся в системном лечении, должны получать пероральные противогрибковые препараты, такие как кетоконазол, итраконазол или флуконазол, в дозе 5 мг/кг один раз в день в течение как минимум 30 дней [36]. Тербинафин 30 мг/кг каждые 24 часа два дня подряд в неделю в течение шести недель также может быть эффективным лечением [37]. Для предотвращения рецидивов заболевания у многих собак может потребоваться регулярная поддерживающая терапия [23].

5.3.Споротрихоз

Споротрихоз — это подкожный микоз, вызываемый диморфным грибком Sporothrix schenckii , который может инфицировать животных и людей [39]. Это зоонозное заболевание, и передача его человеку происходит через укусы или царапины, а также при контакте с язвами кошек [40]. S. schenckii присутствует в разлагающейся растительности и почве, а заражение животных происходит через открытые повреждения кожи, такие как перфорации, укусы и царапины. Попадая в организм хозяина, гриб может вызывать местные поражения и, возможно, системные признаки [41].

Клинически споротрихоз имеет три формы: кожную, лимфокожную и генерализованную, причем у одного и того же животного одновременно могут возникать более одной формы. Кожная форма обычно ограничивается областью заражения грибком и проявляется после инкубационного периода в течение одного месяца. Если это поражение не лечить, может произойти прогрессирование в лимфокожную форму. Лимфокожная форма характеризуется образованием узелков, которые перерастают в язвы, поражающие кожу, подкожную клетчатку, лимфатические сосуды и регионарные лимфатические узлы [41].Летаргия, анорексия, депрессия и лихорадка при физикальном обследовании предполагают наличие диссеминированной формы [42].

Диагноз основывается на истории болезни, физикальном обследовании, цитологической оценке, посевах грибов и результатах гистопатологического исследования [43]. Цитологическая оценка обычно выявляет овальные или удлиненные дрожжевые клетки, соответствующие форме S. schenckii , также могут присутствовать воспалительные клетки [45]. При гистопатологии наличие глубокого пиогранулематозного дерматита, клеточной инфильтрации полиморфноядерных и мононуклеарных клеток и наличие PAS-позитивных структур, совместимых с S.schenckii [44]. Лечением выбора является пероральное введение итраконазола в дозе 10 мг/кг каждые 24 часа [46].

5.4. Криптококкоз

Cryptococcus spp. представляет собой сапрофитный грибок, присутствующий в окружающей среде и в фекалиях голубей, способный вызывать системную инфекцию у собак и кошек, с более высокой заболеваемостью у кошек. В ветеринарии представляют интерес виды C. neoformans , имеющие глобальное распространение, и C.gattii , имеющий ограниченное распространение [47]. C. neoformans обычно заражает животных при вдыхании и может вызывать поражение глаз, верхних дыхательных путей и центральной нервной системы. Могут присутствовать язвенные поражения слизистых оболочек носа, полости рта или глотки или образование в носу (рис. 3) [31]. Микотический ринит и кожное поражение спинки носа и спинки носа являются наиболее частыми находками. У кошек с положительной серологией на вирус кошачьего иммунодефицита (FIV) криптококкоз имеет тенденцию проявляться в диссеминированной или запущенной форме [48].

Диагноз криптококкоза основывается на посевах грибов, цитологическом, гистологическом и серологическом исследованиях [49]. Цитологическое исследование может выявить наличие лейкоцитов, макрофагов и многочисленных инкапсулированных структур (дрожжей) разного размера (рис. 3) [50, 51].

Медикаментозная терапия в большинстве случаев приводит к выздоровлению пациентов [49] и заключается в применении пероральных противогрибковых средств до полной ремиссии клинических признаков, обычно в течение 3–12 мес. Настоятельно рекомендуется не прерывать лечение до снижения титров антител против криптококкоза до нуля [52].Обычно используемые препараты включают флуконазол 50 мг/кошку каждые 12 часов [48] и итраконазол 50-100 мг/кошку каждые 24 часа [52] или 10 мг/кг для собак и кошек каждые 24 часа [49]. Пациентам с новообразованиями носоглотки показана хирургическая резекция для обеспечения проходимости верхних дыхательных путей и уменьшения инфицированной ткани, требующая медикаментозного лечения [52].

Рисунок 3.

Криптококкоз кошек. Рисунок слева: кошка с образованием в носу (красная стрелка). Рисунок справа: Цитология тонкоигольным аспиратом назального образования, показывающая несколько инкапсулированных структур (желтые стрелки), совместимых с C.neoformans (микроскопическое изображение с 100-кратным масляным объективом).

Реклама

6. Паразитарные заболевания кожи

6.1. Демодекоз

Демодекоз — очень распространенное кожное заболевание у собак, но редкое у кошек [53]. Это воспалительное заболевание, при котором в коже обнаруживается большое количество клещей Demodex [54]. Клещи размножаются в волосяных фолликулах и сальных железах, вызывая заболевание [55]. Это распространенное заболевание, и у собак оно часто бывает серьезным. Помимо Demodex canis , сообщалось о двух менее распространенных видах [54, 55]: Demodex sp. cornei и Demodex injai [55]. Демодекоз кошек может быть вызван двумя разными видами клещей: Demodex cati и Demodex gatoi [53].

Клещи передаются от матери потомству в раннем возрасте [56]. D. canis считается комменсалом кожи собак. Считается, что это заболевание является следствием специфической иммуносупрессии, которая способствует размножению клещей [57]. Генетические факторы, вероятно, очень важны в развитии генерализованного заболевания, поэтому разведение больных животных противопоказано [54].

Клиническими признаками могут быть эритема, комедоны, шелушение, частичная или полная алопеция, папулы, фолликулярные цилиндры, пустулы и, в тяжелых случаях, фурункулез, образование корок, экссудация и изъязвление с фокальными дренажными путями. Обычно поражения начинаются на лице и конечностях, но могут стать генерализованными. Демодекоз можно разделить на генерализованный и локализованный. Поражение одной полной области тела, пяти или более очаговых областей или поражение ног считается генерализованным демодекозом.Диагноз ставится на основании глубоких соскобов кожи или трихограммы. В некоторых редких случаях у конечностей или определенных пород, таких как шарпей, эти тесты могут быть отрицательными, что требует биопсии для обнаружения клещей [58].

У большинства собак локализованный демодекоз проходит спонтанно, поэтому специфическая терапия клещами не требуется до генерализации заболевания [53]. Лечение генерализованного демодекоза включает несколько подходов. В дополнение к акарицидной обработке следует также проводить лечение сопутствующих вторичных инфекций и фоновых заболеваний [58].В качестве акарицидного лечения рекомендуется ивермектин в дозе 0,3–0,6 мг/кг перорально 1 раз в сутки, однако лечение рекомендуется начинать с более низкой дозы и постепенно увеличивать дозу вводимого препарата. За животным следует наблюдать на предмет появления побочных эффектов. Терапия моксидектином 0,2-0,5 мг/кг перорально 1 раз в сутки и дорамектином 0,6 мг/кг перорально или подкожно 1 раз в неделю оказалась эффективной при лечении генерализованного демодекоза. Такое же осторожное введение постепенного приема ивермектина следует применять для этих двух других препаратов.Оксим милбемицина также можно применять в дозе 1–2 мг/кг перорально один раз в день с хорошими результатами [58]. Кошкам для лечения демодекоза показаны еженедельные ванны с 2% серной известью. Имеются отдаленные данные, указывающие на еженедельное применение 0,025% амитраза и использование дорамектина 0,6 мг/кг один раз в неделю подкожно [53]. Лечение следует продолжать в течение одного месяца после получения третьего подряд отрицательного соскоба [58].

6.2. Чесотка собак

Чесотка собак является распространенным заболеванием у собак и людей, но редко встречается у кошек, при которых кожа колонизируется клещом Sarcoptes scabiei после контакта с хозяином-донором.Заражение этими клещами вызывает интенсивный зуд [59, 60]. Самки клещей роют ходы в роговом слое, чтобы отложить вылупившиеся яйца, высвобождая формы личинок, которые мигрируют на поверхность кожи, где достигают взрослой стадии [61].

Чрезвычайно раздражающие и зудящие папулезные высыпания, утолщение кожи, эритема, алопеция, экссудация с образованием корок и вторичная бактериальная инфекция с пустулами являются обычными клиническими проявлениями (рис. 4). Хронические поражения обычно ограничиваются краями ушной раковины, локтей и скакательных суставов, что может проявляться утолщением кожи, минимальным образованием корочек и стойким зудом [61].

Соскоб кожи с микроскопической идентификацией S. scabiei является ценным диагностическим методом, хотя во многих случаях клещей почти не видно. Диагноз обычно основывается на истории животного, клинических признаках и положительном пиннопедальном рефлексе (края ушной раковины осторожно царапаются, и собака рефлекторно использует ипсилатеральную заднюю конечность, чтобы почесать источник раздражения) [62, 63].

Лечение рекомендуется больному и другим домашним животным.В качестве эффективного лечения рекомендуется купание с 0,025% раствором амитраза один или два раза в неделю. Терапию следует продолжать в течение двух недель после ремиссии клинических признаков. Во время лечения следует контролировать нежелательные побочные эффекты [64]. Спрей фипронил 0,25% можно применять щенкам три раза с трехнедельными интервалами [65]. Ивермектин можно вводить в дозе от 0,2 до 0,4 мг/кг перорально каждые семь дней или подкожно каждые 14 дней. Лечение обычно занимает от четырех до шести недель [66].Этот препарат противопоказан колли и их помесям [67]. Эффективным альтернативным методом лечения чесотки является точечное применение селамектина в дозе 6–12 мг/кг каждые 15–30 дней в течение как минимум трех применений, и, по-видимому, оно хорошо переносится разными породами [67, 68]. Милбемицин оксим в дозе 2 мг/кг еженедельно, вводимой до пяти раз, также имеет хорошую эффективность [69].

ПРИМЕЧАНИЕ. Разрешение на использование макроциклических лактонов для лечения кошек и собак в каждой стране разное.Правила, касающиеся его использования, должны быть проверены до лечебного учреждения, и владельцы должны быть предупреждены, чтобы разрешить любое использование этих лекарств без этикетки.

Рисунок 4.

Чесотка. Рисунок слева: собака с эритематозными, алопеционными и лихенифицированными зудящими поражениями в дистальных отделах задних конечностей. Рисунок справа: владелец животного с зудящими папулезными поражениями брюшной полости, подчеркивающими зоонозный аспект чесотки.

Реклама

7.Аллергические заболевания

7.1. Блошиный аллергический дерматит

Ctenocephalides felis felis является наиболее важным эктопаразитом у собак и кошек в нескольких странах [70]. Его заражение может вызвать интенсивный зуд, травмы, нанесенные самому себе, и даже такие тяжелые симптомы, как анемия. У некоторых животных развивается тяжелое состояние, известное как блошиный аллергический дерматит (FAD). После сенсибилизации поражения могут быть инициированы всего несколькими укусами блох [71]. Аллергия на блох является одним из наиболее частых состояний у собак, особенно в странах с влажным и теплым климатом, где блохи обычно встречаются [72].Наиболее распространенными клиническими признаками являются эритема, экскориации, корки и пустулы, которые обычно поражают медиально-каудальную часть передних конечностей и брюшную полость; также может наблюдаться пиотравматический дерматит [73].

Диагноз основывается на косвенных доказательствах, таких как клиническая реакция на средства борьбы с блохами. Успешное лечение БАД зависит от устранения источника аллергии — блох. Целями терапии являются полная ликвидация популяции блох в организме больного и окружающей среде, а также у контактных животных.Также важно предотвратить новое заражение, что не всегда просто, поскольку блохи обладают высокой репродуктивной способностью и сложным жизненным циклом [71]. Успехи в борьбе с блохами с помощью современных инсектицидов и регуляторов роста насекомых заметно уменьшили количество пораженных животных. Такие продукты, как фипронил, имидаклоприд, метафлумизон, нинтемпирам, селамектин и спиносад, оказались эффективными для борьбы с блохами у животных с БАД [74]. Эти продукты доступны в нескольких формах: шампуни, ошейники, спреи, порошки, точечные и пероральные препараты [71].

7.2. Неблагоприятная пищевая реакция

Неблагоприятные пищевые реакции описаны в ветеринарии с 1920 г., когда сообщалось о возникновении желудочно-кишечных симптомов и кожных реакций в ответ на пищевые аллергены [75]. Неблагоприятная пищевая реакция относится к любой аномальной клинической реакции, связанной с потреблением пищи или ее добавок [76]. Эта реакция классифицируется как пищевая аллергия (иммуноопосредованная) или пищевая непереносимость (неиммуноопосредованная). Большинство реакций у животных представляют собой пищевую непереносимость и могут быть фармакологического или метаболического происхождения, отравления, идиосинкразии [76, 77], токсичности или анафилактической реакции на пищу [77].Есть некоторые собаки с зудящими кожными заболеваниями или отитом, которые разрешаются с помощью ограничительной диеты, но остается недоказанной иммунологическая причина или гиперчувствительность (аллергия), связанная с кожными неблагоприятными пищевыми реакциями (CAFR). Поскольку этиопатогенез еще не выяснен, следует избегать термина «пищевая аллергия» и более подходящим является CAFR [76, 78]

Породная, половая или возрастная предрасположенность к возникновению клинических признаков отсутствуют. Зуд является наиболее важным симптомом, о котором сообщается, и он поражает в основном лицо, промежность и уши (наружный отит).Также могут наблюдаться желудочно-кишечные симптомы в виде рвоты и диареи. Наилучшим подходом к диагностике CAFR у собак и кошек является кормление их рационом, содержащим только один источник белка, с которым животное никогда раньше не контактировало (новый белок). Диагноз ставится при разрешении клинических признаков после пробной диеты и при возвращении этих признаков при повторном предложении предыдущей диеты. Пробная диета должна проводиться не менее шести недель. Домашние диеты больше подходят для исследования CAFR, описанного выше, но есть также коммерчески доступные рецептурные и гидролизованные диеты [75].

Рецептурные диеты, коммерчески доступные в некоторых странах, состоят из необычного источника белка и неаллергенного источника углеводов, такого как картофель или овсяная мука. Баранина, утка, кролик и мясо кенгуру являются источниками белка, обычно присутствующими в этих диетах [77]. Другой вариант, который считается действительно гипоаллергенным, — это гидролизованная диета. Для человека известно, что большинство пищевых аллергенов представляют собой гликопротеины с молекулярной массой выше 12000 д. Гидролизованные продукты содержат пептиды меньшего размера, что делает их потенциально менее аллергенными [75].Однако небольшой процент собак с аллергией плохо реагирует на гидролизованный корм. Возможность неблагоприятной пищевой реакции на гидролизованный корм у чувствительных собак встречается редко, но ее следует учитывать [79].

Дифференциальный диагноз CAFR проводится с другими видами гиперчувствительности, такими как БАД, атопический дерматит, заболевания, вызванные эктопаразитами, а также дрожжевые или бактериальные инфекции. Эти инфекции могут проявляться и как осложнения зудящего процесса. Терапия должна включать вторичные инфекции и наружный отит.В некоторых случаях также требуется сильный контроль зуда во время применения диеты. Любая медикаментозная терапия должна быть прервана как минимум за три недели до окончания испытания диеты, чтобы клиницист мог оценить реакцию животных на диету [75]. До сих пор неизвестно, развивается ли у животных толерантность к пищевым аллергенам после длительного периода отсутствия контакта, как сообщалось у людей, однако естественная гипосенсибилизация, по-видимому, встречается редко [77].

7.3. Атопический дерматит у собак

Атопический дерматит собак (CAD) представляет собой аллергическое, наследственное, воспалительное и зудящее кожное заболевание с характерными клиническими признаками, связанными с продукцией иммуноглобулина E (IgE) против аллергенов окружающей среды [80].Атопический дерматит также поражает кошек, но его частота ниже, чем у собак [81].

У большинства собак признаки атопического дерматита начинают проявляться в возрасте от шести месяцев до трех лет [82, 83]. Половой предрасположенности не существует, а клинические признаки могут быть сезонными или нет, в зависимости от вовлеченного аллергена. Обычно у пациентов в анамнезе отмечается зуд с вторичными кожными или ушными инфекциями или без них. Первичные поражения включают макулы и папулы, но часто у пациентов появляются вторичные поражения от самоповреждений в виде экскориаций, алопеции, лихенификации и гиперпигментации.Поражения поражают лицо, вогнутую часть ушной раковины, вентральную часть шеи, подмышечные впадины, пах, живот, промежность, вентральную часть хвоста, суставы конечностей, медиальные поверхности конечностей, ступни и уши [85].

У собак, как и у людей, нет патогномоничных признаков атопического дерматита, по которым можно было бы поставить диагноз только на основании анамнеза и физического осмотра. Диагноз зависит от соответствия пациента нескольким критериям, связанным с состоянием, и от исключения дифференциальных диагнозов.После клинического диагноза лабораторные или клинические тесты, такие как тесты на аллергию и гистопатология, подтверждают диагноз. Однако эти тесты следует использовать не для установления диагноза, а для его подтверждения [82]. Важно подчеркнуть тот факт, что у некоторых собак с воспалительными и зудящими кожными заболеваниями, имеющими клинические признаки, идентичные симптомам, обнаруживаемым при ИБС, продукция IgE в ответ на аллергены окружающей среды может отсутствовать. Это состояние известно как «собачий атопический дерматит» [80].Другие дерматозы могут иметь сходные признаки с собачьим атопическим дерматитом или могут быть сопутствующими заболеваниями, поэтому их следует устранять или контролировать до окончательного диагноза ИБС. Дифференциальные диагнозы для ИБС включают БАД, КАФР, зудящие паразитарные заболевания, бактериальную пиодермию, дерматит Malassezia и другие аллергические заболевания [82, 83]. Целями аллергологических тестов являются определение аллергенов, предотвращение контакта и включение в специфическую иммунотерапию аллергии [83]. Ни один тест на аллергию не является полностью чувствительным или специфичным, поэтому клинически здоровые животные могут давать положительный ответ, а животные с отрицательным результатом могут иметь клинические признаки заболевания [82].Аллергенами, обычно связанными с патогенезом ИБС, являются клещи домашней пыли, споры плесени, пыльца деревьев и трав, антигены насекомых и эпидермиса [84].

Атопический дерматит является одним из наиболее распространенных кожных заболеваний у собак, однако его патогенез до конца не ясен, поэтому лечебная терапия пока недоступна [85]. В настоящее время для лечения ИБС доступны различные местные и системные методы лечения, такие как специфическая иммунотерапия аллергии, кортикостероиды, ингибиторы кальциневрина, антигистаминные препараты и незаменимые жирные кислоты.К сожалению, эти методы лечения не во всех случаях эффективны или проявляют побочные эффекты при длительном применении [86]. Для большинства собак с атопическим дерматитом устранение или предотвращение контакта с аллергенами крайне затруднено, а медикаментозная терапия не всегда бывает удовлетворительной, в этих случаях хорошим вариантом является возможность модулировать иммунный ответ на аллергены. Специфическая иммунотерапия аллергии, также известная как гипосенсибилизация, десенсибилизация или противоаллергические вакцины [85], определяется как акт введения увеличенных количеств экстрактов аллергена пациенту с аллергией, чтобы минимизировать симптомы, связанные с воздействием аллергена.Иммунотерапия не подходит для пациентов, которые не продуцируют IgE против аллергенов, имеющих клиническое значение [87]. В результате от 50 до 100% собак, подвергнутых иммунотерапии, могут показать улучшение клинических признаков после четырех месяцев лечения, а у некоторых из этих животных клинические признаки отсутствуют в течение длительного времени [88]. Несмотря на широкое применение в лечении атопического дерматита человека, исследований применения топических кортикостероидов в ветеринарии немного. Триамцинолон 0,015% спрей применялся с хорошими результатами в течение месяца с минимальными побочными эффектами [89].Недавно спрей гидрокортизона ацепоната 0,0584%, наносимый один раз в день на пораженные участки, в дозе два спрея на каждые 100 см2 в течение 84 дней, был заметно эффективен, показывая результаты, аналогичные результатам, полученным при терапии циклоспорином, хотя и без побочных эффектов [90]. . Часто используемые пероральные глюкокортикоиды — преднизолон, преднизолон и метилпреднизолон, которые считаются эффективными и обладают быстрым противоаллергическим эффектом, в дозе от 0,5 до 1,0 мг/кг один или два раза в день. После достижения желаемого эффекта доза может быть уменьшена с сохранением эффективности.Часто наблюдаемые побочные эффекты связаны с дозой и продолжительностью лечения [89]. Ингибиторы кальциневрина в виде 0,1% мази такролимуса, наносимые два раза в день на локализованные поражения, эффективны при лечении ИБС [91]. Хорошую эффективность можно также наблюдать при пероральном приеме циклоспорина в дозе 5 мг/кг один раз в день в течение четырех-шести недель. При применении циклоспорина дозу обычно уменьшают наполовину после получения улучшения клинических признаков с сохранением эффективности. Возможны побочные эффекты в виде рвоты и преходящей диареи.Пероральные антигистаминные препараты десятилетиями использовались для лечения ИБС, однако нет исследований, демонстрирующих убедительные доказательства их эффективности. Побочными эффектами антигистаминных препаратов могут быть седативный эффект и вялость, но эти признаки встречаются редко. Незаменимые жирные кислоты омега-3 и 6 из растительных или рыбных источников используются более 20 лет для лечения атопического дерматита. Они коммерчески доступны в капсулах, жидкости или обогащенной диете. Преимущества терапии жирными кислотами при ИБС неясны, несмотря на многочисленные исследования в этой области, однако они могут снизить дозу кортикостероидов после 8 недель одновременной терапии [89].

Реклама

8. Иммунологические заболевания кожи

8.1. Комплекс пузырчатки

Заболевания комплекса пузырчатки возникают в результате продукции аутоантител, направленных против межклеточного содержимого эпидермиса, что приводит к отделению клеток с образованием внутриэпидермальных булл. Отложение антител способствует физическому разделению клеток; более того, считается, что происходит выброс клеточных протеаз, которые переваривают межклеточное вещество, еще больше усугубляя состояние.Среди форм, наблюдаемых у собак и кошек, можно выделить красную пузырчатку, вульгарную пузырчатку, вегетирующую пузырчатку и листовидную пузырчатку, причем последняя является наиболее распространенным аутоиммунным заболеванием кожи у этих видов [92], которое будет обсуждаться в этой главе.

Листовидная пузырчатка чаще наблюдается у животных среднего возраста, особенно у домашних короткошерстных кошек и у собак некоторых предрасположенных пород, таких как бородатые колли, японские акиты, чау-чау, доберман-пинчеры и ньюфаундленды [93, 94].Это везикуло-буллезное, эрозивное заболевание, которое вызывает выраженный гиперкератоз подушечек стопы. Лицо, туловище и живот также часто поражаются [95, 96]. Также могут присутствовать пустулы, корочки, эритема, алопеция и вторичная пиодермия [94, 96]. В тяжелых случаях могут наблюдаться кахексия и сепсис, вторичные по отношению к инфекции [97].

При наличии пустулезных поражений их можно оценить цитологически и выявить недегенерированные гранулоциты и акантоциты [94]. Гистологически наблюдаются внутриэпидермальные и внутрифолликулярные пустулы с наличием поверхностного периваскулярного дерматита и акантоцитов [92, 93, 98].Гистологическое наличие акантолиза является отличительной чертой комплекса пузырчатки [98].

Терапия требует использования иммунодепрессантов или иммуномодуляторов. Преднизолон, преднизолон и метилпреднизолон обычно используются при лечении пузырчатки. Первоначально рекомендуется доза от 2,2 до 4,4 мг/кг каждые 24 часа для всех трех препаратов. Если терапевтический ответ наблюдается через 14 дней, дозу следует постепенно снижать в течение 30–40 дней. После этого следует ввести дневную дозу через день, достигнув окончательного протокола 1 мг/кг каждые 48 часов или менее [98].В резистентных случаях пузырчатки собак применение преднизолона можно сочетать с азатиоприном (2,2 мг/кг каждые 12 или 24 часа) или циклофосфамидом (50 мг/м2 каждые 48 часов). Кошачья пузырчатка обычно хорошо реагирует на преднизолон, хотя в резистентных случаях может помочь комбинация преднизолона и хлорамбуцила (0,1-0,2 мг/кг каждые 24 часа или через день) [94]. Глюкокортикоиды для местного применения могут использоваться в качестве монотерапии при локализованных формах пузырчатки или использоваться при персистирующих поражениях в качестве дополнительной терапии к системному лечению [98].Смертельные случаи при листовидной пузырчатке в основном связаны с побочными эффектами лекарств, вторичными инфекциями или, во многих случаях, с просьбой об эвтаназии владельца животного [97].

8.2. Дискоидная красная волчанка

Дискоидная красная волчанка (ДКВ) является иммуноопосредованным заболеванием, при котором поражения сходны с таковыми при системной красной волчанке (СКВ), хотя и без присутствия флуоресцентных антинуклеарных антител и без вовлечения других органов систем, как это происходит при СКВ [99].Этиология неизвестна, однако солнечный свет может спровоцировать или усугубить поражение. Наиболее часто поражаемыми участками тела являются лицо и уши. Вначале наблюдаются депигментация, эритема и шелушение. Поражения прогрессируют до чешуйчатых и опухших бляшек. Окончательный диагноз ставится на основании характерной гистопатологии или иммунофлуоресценции. Пораженные животные обычно хорошо реагируют на системную терапию глюкокортикоидами, но местные проявления также являются вариантом лечения [100].Местный такролимус 0,1% может быть альтернативой лечению глюкокортикоидами и оказался эффективным и безопасным при лечении DLE у собак [101].

Объявления

9. Болезни обмена веществ и эндокринной системы

9.1. Гипотиреоз

Гипотиреоз — это эндокринное заболевание, связанное со снижением продукции гормонов Т4 и Т3 щитовидной железой [102]. Редко поражает кошек [103], однако является наиболее распространенной эндокринопатией у собак [104]. Первичная деструкция щитовидной железы встречается более чем у 95% взрослых собак с гипотиреозом [104,105].Гормоны щитовидной железы чрезвычайно важны для поддержания нормальной функции кожи, а дерматологические заболевания встречаются в 60–80% случаев гипотиреоза [106, 107]. Обычными признаками являются изменение качества и окраски шерсти, алопеция (в большинстве случаев двусторонне-симметричная и щадящая голова и конечности), поверхностная пиодермия, сухая и шелушащаяся кожа, сухая или жирная себорея, ломкие и легко выдергивающиеся волосы, гиперкератоз, гиперпигментация, комедоны, отит, недостаточное заживление ран, зуд, микседема и ожирение [108].

Диагноз основывается на клинических признаках, а также на уровне общего ТТГ и свободного Т4 в сыворотке [109]. Гистопатология может показать весьма характерные признаки гипотиреоза, такие как атрофия фолликулов, гиперкератоз, эпидермальный меланоз, большое количество фолликулов в фазе телогена [110], гипертрофия и вакуолизация мышц, выпрямляющих ворсинки, увеличение содержания муцина в дерме и утолщение дермы [111].

Пероральный левотироксин натрия (T4), 20 мкг/кг два раза в день, является препаратом выбора при гипотиреозе [108]. Пациенту следует проводить соответствующее лечение имеющихся дерматологических состояний, хотя они имеют тенденцию исчезать при назначении левотироксина натрия.

9.2. Гиперадренокортицизм

Гиперадренокортицизм, также известный как синдром Кушинга, возникает в результате хронической чрезмерной секреции кортизола надпочечниками. Возникает ятрогенно, после введения синтетических глюкокортикоидов, или спонтанно, как следствие первичной гиперфункции гипофиза или надпочечников. У собак и кошек от 80 до 85% спонтанного гиперадренокортицизма зависят от гипофиза [112]. Пудели, таксы, бостонские терьеры и боксеры — наиболее часто поражаемые породы собак, и это редко встречается у кошек [113].

Обычно наблюдаются такие симптомы, как полиурия, полидипсия, полифагия, гепатомегалия и вздутие живота (внешний вид). Дерматологические признаки включают гипотрихоз, алопецию вдоль спины, как правило, симметричную и двустороннюю, комедоны, пиодермию и себорею [112]. Реже встречаются гиперпигментация, истончение кожи и кальциноз кожи [114]. Клинические признаки, связанные с лабораторной оценкой и результатами диагностической визуализации, позволяют поставить диагноз. АКТГ плазмы, тест подавления низкой дозы дексаметазона, тест стимуляции АКТГ [113, 115] и соотношение кортизол/креатинин в моче [116] подтверждают гиперадренокортицизм.Также важно получить анамнез использования глюкокортикоидов для устранения ятрогенной причины [117].

Терапия гиперадренокортицизма зависит от этиологии, степени тяжести, злокачественности опухоли и доступности вариантов лечения [118]. В гипофиззависимых случаях дисфункции надпочечников хирургическая резекция гипофиза может быть выполнена с низкой летальностью. Адреналэктомия рекомендуется при новообразованиях надпочечников. Медикаментозная терапия гиперкортицизма включает пероральное применение митотана (о, р’-ДДД) в дозе 50 мг/кг один раз в день [113] или перорального трилостана в дозе 2–3 мг/кг один раз в день.У некоторых собак может наблюдаться преходящее ухудшение дерматологических симптомов, особенно при применении митотана. Для полного разрешения дерматологических симптомов обычно требуются месяцы [118].

Объявление

10. Приобретенная алопеция

10.1. Облысение у собак

Облысение у собак является распространенным заболеванием, поражающим короткошерстные породы собак с развитием приобретенной алопеции в определенных областях тела, таких как заушная, вентральная шейная, грудь, живот и каудомедиальная часть бедер [119] ( Рисунок 5).Облысение у собак является эстетической проблемой, не имеющей последствий для здоровья пациентов, однако владельцам может потребоваться лечение. Можно попробовать лечение мелатонином перорально по 5 мг (одна капсула) один раз в день в течение 30 дней, чтобы стимулировать рост волос в областях облысения [119, 120].

10.2. Фолликулярная дисплазия собак

Фолликулярная дисплазия — это наследственное заболевание, характеризующееся аномальным развитием волосяного фолликула, что приводит к структурным аномалиям волос и алопеции [121].Могут поражаться шея, спина и задние конечности, а вторичная пиодермия и комедоны являются обычными клиническими проявлениями [122]. Подтверждение диагноза с помощью гистопатологии выявляет большое количество диспластических фолликулов, диспластических стержней волос и агрегатов меланина внутри волос [123]. Пациенты могут испытать спонтанную ремиссию фолликулярной дисплазии, однако пероральное введение 3 мг мелатонина два раза в день может способствовать возобновлению роста волос [124].

Рисунок 5.

Облысение у собак. Доберман-пинчер с облысением грудной клетки, характерным для паттерн-алопеции (Ветеринарная больница Федерального университета Висозы).

10.3. Алопеция после стрижки

Облысение после стрижки или остановка волосяных фолликулов после стрижки [125] является распространенным, но плохо изученным синдромом у собак, характеризующимся отсутствием шерсти в результате недостаточного роста в ранее подстриженной области [126]. В некоторых случаях волосы могут отрастать годами. При клиническом осмотре кожа нормальная, с четко очерченными участками алопеции. Диагноз завершается наличием в анамнезе алопеции после стрижки при отсутствии других дерматологических признаков.При наличии каких-либо системных признаков или других кожных заболеваний рекомендуется выполнить соответствующие лабораторные процедуры для поиска эндокринопатий [125]. Обычно лечение не требуется [122]

10.4. Алопеция X

Алопеция X — это заболевание, ранее известное как врожденная гиперплазия надпочечников, синдром Кушинга, дерматоз, реагирующий на кастрацию, и гипосоматотропизм у взрослых [127]. Это состояние, связанное с аномалиями в цикле волосяного покрова, затрагивающее в основном немецкую породу шпиц.У больных животных появляются волосы в фазе телогена, что предотвращает рост новых волос [128]. Эти животные клинически здоровы и демонстрируют прогрессирующее выпадение волос, симметричное и не зудящее, с различной степенью гиперпигментации [129]. Результаты гистопатологии аналогичны тем, которые обнаруживаются при эндокринопатиях, таких как комедоны, поверхностная гиперкератинизация и гиперкератинизация воронки, однако наличие катагенизации с образованием пламенных фолликулов подтверждает диагноз алопеции X [127].

Терапия половыми гормонами, гормоном роста, митотаном и кастрация обычно не дают стабильных результатов.Трилостан в дозе 10,5 мг/кг один или два раза в день может привести к полному росту шерсти у пораженных животных после четырех-восьми недель лечения [129].

11. Нарушения кератинизации

11.1. Себорея

Себорейный дерматит представляет собой нарушение ороговения кожи, которое может быть первичным или вторичным. Первичные нарушения ороговения передаются по наследству и проявляют породную предрасположенность. Обычно клинические признаки появляются в возрасте до двух лет [130]. Около 90% случаев являются вторичными по отношению к основному заболеванию [131,132], такому как метаболические, наследственные или алиментарные нарушения [133], которые вызывают чрезмерное шелушение кожи [131,132].

Себорея классифицируется как сухая или жирная себорея в зависимости от внешнего вида волос и кожи [131, 132]. При сухой себорее шерсть непрозрачная и сухая, содержащая агрегаты от белых до сероватых чешуек, а при жирной себорее имеются спайки липидного материала от желтоватого до коричневого цвета, имеющие жирный вид [130]. У животных часто проявляются зуд, фолликулит, пиодермия, воспаление и образование бляшек гиперкератоза [131,132].

Диагноз основывается на анамнезе, клинических признаках, результатах физикального обследования и дополнительных обследованиях для исключения дифференциального диагноза или определения основного заболевания.Часто для уточнения диагноза необходимо выполнить соскобы кожи, посев грибков и бактерий, аллергические пробы, оценку эндокринной функции, биопсию кожи и оценку ответа на терапию. Гистопатология выявляет аномальное ороговение эпидермиса и волосяных фолликулов, ортокератотический и паракератотический гиперкератоз, фолликулярный гиперкератоз, дискератоз и периваскулярный поверхностный дерматит [130].

Целями лечения себореи являются удаление чешуек и корочек, уменьшение кожного сала, зуда и воспаления [131,132].Случаи первичной идиопатической себореи можно лечить пероральным приемом витамина А (от 600 до 800 МЕ/кг два раза в день) или ретиноидами, такими как изотретиноин и этретин (1–2 мг/кг каждые 12 часов) [134]. Рекомендуются шампуни с салициловой кислотой и серой, которые могут дать положительные результаты в умеренных случаях. Дегтярные шампуни рекомендуются при тяжелых случаях жирной себореи у собак, однако они противопоказаны кошкам [135]. Вторичные случаи имеют отличный прогноз при устранении основного заболевания, в то время как первичные нарушения кератинизации требуют пожизненного контроля и лечения [130].

11.2. Акне

Акне — распространенное заболевание у кошек, которое может быть результатом идиопатического дефекта кератинизации или вторичной реакцией на другое заболевание [136]. Наиболее распространенные кожные изменения обнаруживаются на подбородке и краю губ и включают комедоны, корки, папулы, эритему, алопецию и переменный зуд. Обычно это заболевание протекает с вторичной бактериальной пиодермией, а в некоторых случаях с инфекциями M. pachydermatis [137]. Папулы, пустулы, фурункулез и целлюлит могут быть признаками вторичной инфекции.Возможными причинами этого расстройства являются изменения в цикле волосяных фолликулов, иммуносупрессия, стресс, недостаточный уход и сопутствующие вирусные инфекции [136]. Гистология показывает перидуктальное лимфоплазмоцитарное воспаление, дилатацию протоков сальных желез и фолликулярный кератоз с обструкцией и дилатацией фолликулов [137]. Легкие случаи можно лечить антисеборейным шампунем; однако в тяжелых случаях требуется сочетание системной антимикробной терапии или системных кортикоидов [136]. Мазь мупироцина 2% эффективна при нанесении на очаги поражения два раза в день [138].Третиноин для местного применения в дозе 0,01–0,025% (лосьон или мазь) улучшает клинические признаки в хронических случаях [139, 140]. Правильное распознавание и лечение вторичных инфекций способствуют успешной терапии [137]. У кошачьих акне прогноз хороший, однако для контроля состояния часто необходимо симптоматическое пожизненное лечение [140].

12. Психогенные заболевания

12.1. Акральный дерматит

Акральный дерматит характеризуется изъязвлениями, пролиферативными, твердыми и облысенными бляшками, возникающими в результате компульсивного вылизывания дистальных отделов конечностей [141] (рис. 6).Вторичная бактериальная инфекция встречается часто и способствует сильному зуду поражений [142]. Это состояние может быть вызвано психогенными (состояния, основанные на страхе и/или тревоге), дерматологическими (вторичными по отношению к гиперчувствительности, демодекозу, новообразованиям и грибковым или бактериальным инфекциям), травматическими, невропатиями или заболеваниями суставов [141, 142].

Диагноз требует полной клинической оценки (анамнез, физикальное, неврологическое и дерматологическое обследование), полного подсчета клеток крови, биохимического профиля сыворотки и анализа мочи.Только после устранения возможных органических причин акрального дерматита его можно считать поведенческим расстройством. В этом случае следует оценивать поведение животного, наблюдая за его экологическими и социальными стимулами и их мотивационным статусом. Лечение акрального дерматита, как известно, является сложной задачей. Окружающая среда животного должна быть изменена, чтобы устранить или свести к минимуму воздействие факторов стресса [142], а использование антидепрессантов, таких как флуоксетин в дозе 20 мг/день, может значительно помочь в контроле навязчивых состояний, что улучшает состояние поражений [143].

Рисунок 6.

Акральный лизунчатый дерматит. Изъязвленные бляшки с некрозом тканей в дистальном отделе передней конечности собаки.

13. Пищевые болезни кожи

13.1. Дерматоз, чувствительный к витамину А

Витамин А необходим для поддержания целостности эпителиальной ткани и особенно важен в процессе кератинизации [144]. Дерматоз, чувствительный к витамину А, является необычным состоянием, наблюдаемым в основном у правильно питающихся кокер-спаниелей [145], которое может проявляться шелушением кожи, зудом, жирностью кожи, характерными гиперкератотическими бляшками и вторичной пиодермией [144].Гистопатология выявляет фолликулярно-ориентированный обильный гиперкератоз [145].

Поражения не улучшаются при антисеборейной терапии, но пероральные добавки витамина А (ретинола) в дозе 10 000 МЕ один раз в день обеспечивают клиническое улучшение через 5–8 недель лечения. Обычно необходимо пожизненное лечение [144].

13.2. Цинк-чувствительный дерматоз

Цинк необходим для клеточного метаболизма, а также для поддержания здоровья волос и кожи [144]. Цинк-чувствительный дерматоз является необычным заболеванием у собак и характеризуется шелушением, очаговой эритемой, корками и алопецией, в основном на голове [146].

У собак распознаются два синдрома. Синдром I поражает молодых взрослых собак, которых кормят сбалансированным рационом, особенно сибирских хаски и аляскинских маламутов, однако сообщалось о нем и у других пород [146, 147]. У больных животных снижена способность абсорбировать цинк из кишечного тракта из-за какого-либо субклинического заболевания или генетических факторов [144]. Синдром II наблюдается у быстрорастущих щенков, особенно гигантских пород, которых кормят рационом с дефицитом цинка или избыточным содержанием фитата кальция [144, 146].

Диагноз ставится на основании анамнеза, клинических признаков, характерных поражений, породы, результатов биопсии кожи и реакции на добавки цинка. Обнаруженные гистопатологические аномалии представляют собой папиллярную эпидермальную гиперплазию, сливающийся спонгиотический паракератоз и гнойные корки [146].

Контроль синдрома I требует пожизненной пероральной добавки цинка с метионином цинка 1,7 мг/кг один раз в день, глюконатом цинка 5 мг/кг один раз в день или сульфатом цинка 10 мг/кг один раз в день [14]. В случаях, невосприимчивых к пероральным добавкам, можно было внутривенно вводить сульфат цинка в дозе от 10 до 15 мг/кг один раз в неделю, сначала в течение четырех недель, а затем каждую неделю до шести месяцев [144].Прогноз в большинстве случаев благоприятный, хотя может потребоваться прием добавок на протяжении всей жизни. Больные животные должны быть исключены из разведения [147].

Синдром II имеет отличный прогноз и требует только сбалансированного питания для восполнения дефицита цинка, однако признаки ремиссии наступают быстрее при пероральном приеме цинка [144].

13.3. Болезни наружного уха

Наружное ухо делится на три отдела: внутреннее, среднее и наружное ухо. Наружное или наружное ухо состоит из ушной раковины, вертикального канала и горизонтального канала, образованных ушным и кольцевым хрящами.Диаметр наружного слухового прохода варьируется в зависимости от возраста, породы и размера животного, и он отделен от среднего уха барабанной перепонкой, тонкой полупрозрачной мембраной эллиптической формы [148]. Заболевания наружного уха имеют особое значение в ветеринарной дерматологии, поскольку наружное ухо формируется в эмбриональной жизни посредством инвагинации кожи и подвержено ряду дерматологических заболеваний [149]. Наружный отит — наиболее частое заболевание наружного слухового прохода у собак и кошек, заключающееся в воспалении его эпителия [150,151].

Для постановки правильного диагноза и успешного лечения важно распознать и понять основные предрасполагающие и поддерживающие причины. Первичными причинами являются факторы или процессы, вызывающие воспаление в наружном канале [152]. Наиболее частыми триггерными факторами являются паразитарная инвазия ( Octodetes cynotis, Demodex canis, Sarcoptes scabiei, Notroedes cati ), инородное тело, аллергические заболевания и реакции гиперчувствительности (атопический дерматит, пищевая аллергия, контактный аллергический дерматит), нарушения кератинизации (себорея, сальный аденит). ), гормональные нарушения и аутоиммунные заболевания (пузырчатка, красная волчанка).Предрасполагающими причинами являются факторы и процессы, повышающие риск развития отита, такие как строение уха (узкий слуховой проход, чрезмерное оволосение слухового прохода, длинные и висячие уши), чрезмерная влажность (ванны, привычка плавать), ятрогенные факторы (употребление ватных тампонов для очистки уха, использование раздражающих чистящих растворов) и возникновение обструктивных заболеваний уха (полипы и новообразования) [151].

Факторами, способствующими развитию отита, являются бактериальная инфекция ( Staphylococcus pseudintermedius, Pseudomonas aeruginosa ), дрожжевая инфекция ( M.pachydermatis ) и осложнения среднего отита, такие как сужение слухового прохода из-за гиперплазии и кальцификации хрящевых структур [151,153,154].

Начальным признаком наружного отита является эритема ушной раковины и наружного слухового прохода. Ухудшение симптомов может привести к тряске головы, зуду в ушах, зловонным гнойным или церуминозным выделениям, отеку, боли и признакам самотравмы в виде ушной гематомы и острого мокнущего дерматита в области основания ушей. Хронический или рецидивирующий отит может привести к гиперплазии мягких тканей, стенозу и окклюзии слухового прохода [151].

Диагноз требует физического и дерматологического осмотра, знания дерматологического анамнеза и развития клинических признаков. Отоскопическое исследование является методом первого выбора для оценки наружного слухового прохода [155], и его следует проводить каждому пациенту с признаками отита [156]. Важно отметить, что в здоровом слуховом проходе может быть небольшое количество желтоватой или коричневой серы [150]. С помощью отоскопии клиницист может определить наличие воспаления, экссудата, гиперплазии, стеноза, инородного тела, новообразований и оценить состояние барабанной перепонки.В зависимости от степени боли, воспаления и стеноза может потребоваться применение местных или системных кортикоидов в течение двух-трех недель перед выполнением отоскопического исследования [156].

Для постановки диагноза требуется цитологический анализ, образцы должны быть получены как из ушной раковины, так и из наружного вертикального и горизонтального канала. Цитология может предоставить раннюю информацию о воспалительной реакции и микробных организмах или паразитах, вовлеченных в процесс [150].

Успешная терапия основана на: устранении или контроле основной причины и предрасполагающих факторов; устранение бактериальной и дрожжевой инфекции, паразитарной инвазии и инородных тел слухового прохода; чистка ушной раковины, вертикального и горизонтального канала; удаление мусора, экссудата и ушной серы.Также чрезвычайно важно проинструктировать владельца о методах очистки и методах введения местных лекарств [150].

Грамположительные бактериальные инфекции можно лечить местными стероидными антибиотиками (фузидовая кислота) и местными фторхинолонами (марбофлоксацин и орбифлоксацин). Грамотрицательные инфекции также можно лечить фторхинолонами или топическими катионными полипептидами (полимиксин В) и аминогликозидами (неомицин, фрамицетин, гентамицин) [154]. Аминогликозиды противопоказаны при разрыве барабанной перепонки из-за их ототоксичности [150]. Виды Malassezia обычно чувствительны к азолам (клотримазол и миконазол) и полиеновым макролидам (нистатин) [154].

Использование местных препаратов, таких как моксидектин 1% и имидаклоприд 10% (0,1 мг/кг, два применения с двухнедельным интервалом), эффективно при инвазии Otodectis cynotis у кошек [157].

Животных с острым отитом следует лечить два раза в день в течение 7–14 дней. Хронические или рецидивирующие случаи следует лечить не менее 4 недель, и в сочетании с местной терапией рекомендуются системные противовоспалительные препараты (преднизолон или преднизолон 0.5 мг/кг каждые 12 ч) [158]. Глюкокортикоиды эффективно контролируют воспаление и могут предотвратить или обратить вспять гиперплазию тканей и стеноз канала [154]. Терапию следует прекратить только при отрицательном результате цитологического исследования на микроорганизмы, отсутствии отека слухового прохода и нормальном внешнем виде эпителия [158].

Дерматозы с «воротничком кожи»

Ошейник в дерматологии означает «узкий ободок отслоившегося кератина, выступающий за периферию ограниченного поражения кожи, прикрепленный к нормальной окружающей коже.» [1] Внешний край воротника приклеен, а внутренний край свободен. Однако на практике кожа, образующая воротничок, может быть чешуйчатой ​​(например, при розовом лишае, эксфолиативном кератолизе и т. д.) или толстой и валикообразной, образующей ободок вокруг поражения (например, акральная фиброкератома, вирусные бородавки и т. д.). . Хотя многие расстройства в первую очередь имеют такую ​​морфологию [Таблица 1], она может быть вторичным или неспецифическим проявлением в некоторых других.

Таблица 1: Дерматозы с воротничком шелушения

Нарушения кератинизации

Розовый лишай

Розовый лишай является распространенным, приобретенным, самокупирующимся папулосквамозным заболеванием, обычно поражающим детей и молодых людей.Возможная инфекционная роль в его патогенезе предполагалась, но однозначно не доказана. Классически заболевание начинается как эритематозное пятно с периферическим ободком мелких чешуек, которое в течение следующих нескольких дней увеличивается в виде пятна от кольцевидного до овального («геральдическое пятно», «материнское пятно»), обычно вовлекающего туловище. Чешуйки выглядят как воротнички и характерно отстают от наружного эритематозного края пятна – «висячие чешуйки» или «симптом висячей занавески» [Рисунок — 1].В течение следующих 1-2 недель множественные зудящие очаги меньшего размера, похожие на геральдические пятна, развиваются преимущественно на туловище, распространяясь до проксимальных отделов рук. На спине длинные оси этих повреждений выровнены параллельно расслабленным линиям натяжения кожи, создавая вид «рождественской елки». [2],[3] Заболевание является самоограничивающимся и проходит спонтанно примерно через 6 недель. [2] Описаны атипичные формы. Несмотря на безвредность, розовый лишай, возникающий в первом триместре беременности, может быть причиной повышенного риска самопроизвольного аборта, преждевременных родов, детской гипотонии и гипореактивности. [4],[5] Лекарственная сыпь, похожая на розовый лишай, также может возникать при приеме некоторых лекарств. [6]

Рисунок 1: Розовый лишай

Эксфолиативный кератолиз

Эксфолиативный кератолиз представляет собой распространенное невоспалительное очаговое или диффузное шелушение кожи ладоней и реже подошв. Обычно протекает бессимптомно, обычно поражает здоровых людей.Это обычное явление летом и усугубляется теплым климатом. Клинически он характеризуется дискретными крошечными пузырьками, заполненными воздухом, которые разрываются и расширяются в виде неправильных кольцевых или кольцевидных узоров до 10 мм, с характерным периферическим воротничком шелушения [Рисунок 2]. Эксфолиативный кератолиз считается более легким вариантом дисгидротической экземы или связан с атопией. Чанг и др. предполагают, что это расстройство представляет собой отчетливое расстройство шелушения, возникающее в основном из-за преждевременного корнеодесмолиза. [7],[8],[9]

Рисунок 2: Эксфолиативный кератолиз

Буллезный ихтиоз Сименса (поверхностный эпидермолитический ихтиоз)

Буллезный ихтиоз Сименса — аутосомно-доминантное заболевание ороговения, которое рассматривается как поверхностный вариант буллезной врожденной ихтиозиформной эритродермии (эпидермолитический гиперкератоз).Это происходит из-за мутации в гене кератина 2e . Клинически он характеризуется поверхностными волдырями, вызванными травмой, которые спонтанно разрываются, оставляя после себя оголенную кожу с кольцевидными воротничковыми чешуйками по краям, классически называемым феноменом mauserung (линька эпидермиса). Обычно поражаются изгибы, нижняя часть живота и претибиальные области, которые также могут иметь сероватый, волнистый, чешуйчатый гиперкератоз. Заболевание обычно начинается в неонатальном периоде и распространяется на детский возраст, а иногда может сохраняться и во взрослом возрасте.Гистопатологические признаки сходны с таковыми при эпидермолитическом гиперкератозе, но ограничиваются поверхностным эпидермисом. Вакуолизированные кератиноциты в верхнем шиповатом слое являются важным диагностическим признаком. [10],[11]

Порокератоз

Порокератоз представляет собой группу нарушений кератинизации, характеризующихся общим проявлением краевого кератотического воротничка, который гистопатологически соответствует вертикальным столбикам паракератоза (венечным пластинкам).Различные клинические формы порокератоза можно условно разделить на диссеминированные (актинические, детские и иммуносупрессивные) и локализованные (мибеллиевские, линейные, точечные, гигантские и ладонно-подошвенные) формы. Распространенный актинический тип является наиболее распространенной формой порокератоза. За исключением точечной формы, все типы имеют общий патогномоничный край ороговевшего гребня, окружающего центральную красноватую, сухую и атрофическую кожу [Рисунок — 3]. Периферический гребень также может быть бороздчатым. Эта отличительная черта порокератоза хорошо визуализируется при дерматоскопии, что позволяет избежать необходимости биопсии даже в клинически атипичных случаях.Плоскоклеточная карцинома может редко развиваться при длительных поражениях, с большей частотой при линейной и гигантской формах. [12],[13],[14]

Рисунок 3: Порокератоз

Инфекционные болезни

Кандидоз кожи

Кандидоз относится к инфекции, обычно вызываемой дрожжами Candida albicans .Кожный кандидоз может проявляться врожденным и неонатальным кандидозом, пеленочным дерматитом и кандидозной интертриго. Клинически поражения выглядят как эритематозные эрозированные пятна с краевыми и сателлитными пустулами. Пустулы разрываются, образуя бахромчатый неровный фестончатый край с воротничком из чешуек [Рисунок 4]. Обычно вовлекается аногенитальная область, а поражения, затрагивающие складки голени, неизменно демонстрируют глубокую центральную расщелину. [15],[16]

.
Рисунок 4: Кандидозная опрелость.Обратите внимание на характерную зубчатую кайму с воротником из чешуи

Буллезное импетиго

Импетиго относится к поверхностной бактериальной инфекции, в основном протекающей в двух клинических формах: небуллезной и буллезной. В то время как первый вызывается как стафилококками, так и стрептококками, последний вызывается штаммами, продуцирующими эпидермолитический токсин (группа II, фаговые типы 71, 55, 3A и 3C) Staphylococcus aureus , которые гидролизуют десмоглеин 1, что приводит к вялым внутриэпидермальным волдырям.Буллезное импетиго обычно поражает детей в возрасте от 2 до 5 лет. Хотя может быть поражен любой участок, включая ладони и подошвы, часто поражаются изгибы, где поражения начинаются с крошечных пузырьков, которые увеличиваются, образуя вялые буллы размером до 2 см. Первоначально буллы содержат прозрачную жидкость, которая затем становится гнойной. После разрыва буллы видны сырые эрозии и корки, напоминающие волдырь, образующий патогномоничный воротничок по краю эрозии [Рисунок 5]. [17],[18],[19]

Рисунок 5: Буллезное импетиго

Вторичный сифилис

Сифилис — венерическое заболевание, вызываемое спирохетой Treponema pallidum , протекающее в первичной, вторичной и третичной стадиях, с длительным и хроническим течением при отсутствии лечения. Папулезные поражения являются наиболее заметными кожными проявлениями вторичной стадии сифилиса, которые следуют за исчезающей медно-красной пятнистой сыпью.Папулезные поражения поражают туловище и конечности, включая ладони и подошвы. Они характеризуются эритематозными или коричневато-красными дискретными папулами размером 0,5–2 см, часто демонстрирующими патогномоничный воротничок из чешуек на поверхности [Рис. 6], который более заметен на ладонно-подошвенных поражениях. Этот воротник шелушения был впервые описан французским дерматологом швейцарского происхождения Лораном-Теодором Биеттом и назван в его честь «воротничком Биетта» или «симптомом Биетта». Дерматоскопически воротничок выглядит как непрерывное белое кольцо чешуек, окружающее центральную эритематозную папулу с окружающим ее эритемным ободком [Рисунок 6]b. [20],[21],[22]

Рисунок 6

Бациллярный ангиоматоз

Бациллярный ангиоматоз — в первую очередь вазопролиферативное заболевание, наблюдаемое у пациентов, инфицированных вирусом иммунодефицита человека (с числом клеток CD4+ <50 мм -3 ), вызываемое Bartonella henselae и Bartonella quintana. Кожный бациллярный ангиоматоз проявляется в различных формах.Наиболее распространены диссеминированные ангиоматозные папулы, напоминающие пиогенную гранулему. Они нежные, часто на ножке и окружены воротничком из чешуек. [23],[24],[25],[26] Подобные поражения могут также поражать внутренние органы. [27] Биопсия кожи выявляет агрегаты пухлых эндотелиальных клеток с люминальной дифференцировкой в ​​бледной строме. Патогномоничным признаком является наличие нейтрофильного инфильтрата по всему очагу поражения, связанного с мутными амфофильными участками, представляющими микроорганизмы, которые окрашиваются метенаминовым серебром по Гимзе, Уортину-Старри и Грокотту. [26],[28]

Стафилококковый блефарит

Стафилококковый блефарит обычно вызывают Staphylococcus aureus и Staphylococcus epidermidis . Обычно имеется односторонняя локализованная эритема и отек переднего края века, связанные с патогномоничными ломкими фибринозными чешуйками, образующими воротничок вокруг основания ресничек. По мере роста ресниц приподнятые чешуйки приподнимаются. Другие признаки, которые можно увидеть, включают расширенные кровеносные сосуды на краю века, расположенные в виде розеток, мадароз, локальные изъязвления и/или полиоз.Инфекция может распространяться на задний край века, а затем на конъюнктиву и периферию роговицы, проявляясь фолликулярным конъюнктивитом и краевым кератитом. [29],[30],[31]

Кератолиз с ямками

Ямочный кератолиз представляет собой поверхностную бактериальную инфекцию, вызываемую различными микроорганизмами ( Kytococcus sedentarius, Dermatophilus congolensis, Actinomyces и Corynebacterium spp.), которая обычно поражает опорные участки подошвы в жарком и влажном климате.Повреждения в этих местах выглядят как зловонные дискретные поверхностные ямки, которые могут сливаться в более крупные невоспалительные эрозии. Поражения могут редко возникать на ладонях и не несущих вес участках стоп, где они обычно выглядят как воротничок из чешуек, а не ямки, напоминающие эксфолиативный кератолиз (см. выше). [32],[33],[34],[35]

Подошвенные бородавки

Подошвенные бородавки обычно вызываются вирусом папилломы человека 1.Иногда их бывает трудно отличить от мозолей и мозолей. Тем не менее, подошвенные бородавки стирают дерматоглифику и демонстрируют мягкую сердцевину (в отличие от твердой сердцевины мозолей) с точечными кровоточащими пятнами или внутрикапиллярным тромбозом на поверхностном соединении пораженных участков (не наблюдается при мозолях и мозолях). Подошвенные бородавки четко очерчены и имеют воротничок из приподнятой нормальной кожи. Поверхностное соединение поверхности бородавки через этот воротничок показывает резкое окончание эпителиальных гребней нормальной подошвенной кожи в этой точке [Рисунок 7].Толстый приподнятый ороговевший воротничок также можно увидеть вокруг старой бородавки в других частях тела. [4],[36],[37],[38],[39],[40],[41],[42],[43],[44],[45],[46],[ 47],[48]

Рисунок 7: Подошвенные бородавки с венчиком выпуклости вокруг нормальной кожи. Обратите внимание на резкое окончание дерматоглифики на внутреннем крае воротничка.

Пузырно-пустулезные заболевания

Транзиторный пустулезный меланоз новорожденных

Транзиторный пустулезный меланоз новорожденных является одним из транзиторных неонатальных пустулезов, характеризующихся поверхностными невоспалительными везикулами или пустулами, которые спонтанно вскрываются, оставляя после себя характерный воротничок из белых чешуек.Позже эти чешуйки сменяются поствоспалительной гиперпигментацией, которая постепенно проходит в течение нескольких недель. Обычно поражаются область головы и шеи и/или нижние конечности, и это состояние почти исключительно у доношенных новорожденных африканского происхождения. Некоторые авторы полагают, что это вариант токсической эритемы новорожденных; однако большинство поражений наблюдается при рождении, а стерильные пустулы состоят из нейтрофилов, в отличие от эозинофилов при токсической эритеме новорожденных. [39],[40]

Подкорнеальный пустулезный дерматоз (болезнь Снеддона-Уилкинсона)

Субкорнеальный пустулезный дерматоз — редкий, хронический, ремиттирующий и рецидивирующий пустулезный дерматоз, обычно поражающий женщин среднего возраста. Клинически поражения выглядят как вялые стерильные пустулы на нормальной или эритематозной коже. Поражения обычно склонны к изгибам и появляются в посевах с тенденцией к слиянию, образуя различные узоры — кольцевидные, полициклические, серпигинозные или цирцинатные.Типичным признаком является образование уровня жидкости внутри волдыря по мере скопления гноя в зависимой части и прозрачной жидкости сверху. Повреждения вскрываются через несколько дней и подсыхают, образуя корки и чешуйчатые чешуйки. Гистопатологически наблюдается скопление нейтрофилов непосредственно под роговым слоем. [41],[42]

Пустулезный псориаз

Пустулезный псориаз, как генерализованный, так и локализованный, характеризуется образованием стерильных пустул на пятнистой или сливной эритеме.Пустулы начинаются как отдельные крошечные поражения, которые могут сливаться, образуя озера гноя. Через несколько дней они лопаются и подсыхают, оставляя после себя эрозии, окруженные воротничком шелушения [Рис. 8]. При генерализованных формах (фон Цумбуша и герпетиформное импетиго) кожным поражениям предшествуют лихорадка и системные жалобы. Пустулы располагаются на туловище и конечностях и обычно появляются волнообразно, сопровождаясь лихорадкой. Локализованная форма пустулезного псориаза обычно поражает руки и ноги (ладонно-подошвенный пустулез и континуум акродерматита Аллопо) и, хотя не связана с какими-либо системными эффектами, хронический и персистирующий характер заболевания значительно влияет на качество жизни пациентов [Рисунок — 9]. ]. [43],[44]

Рисунок 8: Пустулезный псориаз
Рисунок 9: Пальмарный пустулез

Острый генерализованный экзантематозный пустулез

Острый генерализованный экзантематозный пустулез — это острый фебрильный экзантематозный пустулез, обычно возникающий как побочная кожная реакция на лекарства.Аминопенициллины, сульфаниламиды, хинолоны, гидроксихлорохин и блокаторы кальциевых каналов являются часто причастными препаратами. Поражения обычно появляются через 24–48 часов после приема возбудителя, часто на сгибах в виде крошечных нефолликулярных пустул на эритематозном основании, которые постепенно распространяются на туловище и конечности. Повреждения спонтанно инволюционируют через пару недель, оставляя после себя типичный воротничок шелушения. Расстройство, как правило, доброкачественное, хотя вторичная инфекция поражений может осложнить обычное течение без осложнений. [45],[46],[47]

Круговая эритема

Кольцевидная центробежная эритема

Кольцевидная центробежная эритема представляет собой реактивную мигрирующую эритему, которая, как предполагается, связана с некоторыми инфекциями (инфекцией, вызванной вирусом Эпштейна-Барр, опоясывающим герпесом, контагиозным моллюском, кандидозом, дерматофитными инфекциями и т. амитриптилин и др.) и некоторые другие заболевания, такие как саркоидоз, заболевания печени и щитовидной железы, гематологические заболевания и злокачественные новообразования паренхиматозных органов. Однако ни одна из этих ассоциаций не была доказана бесспорно. Он подразделяется на поверхностный тип (по Колкотту Фоксу) и глубокий тип (по Дарье) с отчетливыми клиническими и гистопатологическими особенностями. Болезнь обычно поражает взрослых, и поражения преимущественно ягодиц, бедер и туловища. Поражения начинаются как эритематозные папулы, которые медленно мигрируют и центробежно увеличиваются, достигая до 10 см в диаметре с просветлением в центре.Периферический край приподнят достаточно, чтобы его можно было пальпировать или сделать толстым шнуром. Поверхностный вариант имеет типичные висячие чешуйки воротничка (как при розовом лишае, а гистологически демонстрирует спонгиоз, паракератоз и поверхностный периваскулярный мононуклеарный инфильтрат). «рукав») без изменений эпидермиса [48],[49],[50],[51]

Эритема ползучая

Erythema gyratum repens — паранеопластическая воспалительная извилистая эритема, чаще всего возникающая в связи с карциномой легкого.Чаще наблюдается у мужчин старше четвертого десятилетия. Сообщалось также о других гематологических и солидных злокачественных новообразованиях органов. Клинически обычно поражаются туловище, шея и конечности, а поражения характеризуются сильно зудящими мигрирующими эритематозными концентрическими волнообразными полосами. Характерной особенностью является быстрая скорость миграции переднего края (1 см/день) и развитие новых извилистых поражений внутри ранее существовавших, придающих вид концентрических полос, напоминающих текстуру древесины.На самом внешнем крае видны чешуйки воротника, которые могут тянуться за край. Несмотря на то, что гистопатологические признаки ползучей эритемы являются неточными, отличительные клинические характеристики, тем не менее, требуют обследования пациента на наличие скрытой неоплазии. Резекция опухоли приводит к разрешению поражений. [52],[53],[54]

Опухоли кожи

Светлоклеточная акантома (бледноклеточная акантома, опухоль degos)

Светлоклеточная акантома была впервые описана Degos et al .в 1962 г. [55] Опухоль обычно поражает ноги и стопы мужчин и женщин среднего возраста. Обычно он выглядит как одиночная ограниченная куполообразная папула или узелок с пигментированной чешуйчатой ​​поверхностью и характерным воротничком из белых чешуек, окружающих очаг поражения. Описаны также множественные, полипоидные и гигантские формы. Дерматоскопия опухоли показывает центральные кровеносные сосуды, ориентированные перпендикулярно поверхности кожи, и периферический плоскоклеточный воротничок. Сходные признаки можно наблюдать при псориазе и болезни Боуэна, поэтому для окончательного диагноза необходимы клиническая корреляция и гистопатологическое исследование.Отличительные гистопатологические особенности опухоли Дегоса включают акантотический эпидермис с обилием светлых клеток, спонгиоз, гипо- или агранулез и удлинение сетчатых гребней. Прозрачные клетки имеют полиэдрическую форму и крупнее кератиноцитов, проявляют положительную реакцию и чувствительность к окрашиванию периодической кислотой по Шиффу и диастазной реакции соответственно. [56],[57]

Пиогенная гранулема

Пиогенная гранулема является распространенной приобретенной доброкачественной сосудистой опухолью, появляющейся в основном в виде быстро растущих, одиночных, рыхлых сосудистых папул или узелков на ножке.Окружающий чешуйчатый воротничок виден у основания поражения в большинстве случаев [Рис. 10]. Пиогенная гранулема обычно наблюдается у детей и молодых людей с частым поражением конечностей и лица. Травма является наиболее частым фактором, влияющим на его этиопатогенез. Дольковая пролиферация капилляроподобных сосудов в рыхлой строме является патогномоничным гистопатологическим признаком. [28],[58],[59] Дерматоскопия показывает центральную сосудистую область и периферический воротничок.Центральная сосудистая зона может иметь разный рисунок – красный однородный участок, изъязвление с геморрагическими корками или белые «рельсовые линии» на красноватом однородном фоне, пересекающие очаг поражения. [60]

Рисунок 10: Пиогенная гранулема

Акральная фиброкератома

Акральная фиброкератома (приобретенная цифровая фиброкератома) — солитарная доброкачественная опухоль у взрослых, часто поражающая пальцы рук и ног.Отличительной чертой опухоли является рвообразное кольцеобразное воротничок толстой приподнятой кожи, окружающий центральную куполообразную папулу или узелок с бородавчатой ​​поверхностью [Рис. 11]. Дерматоскопические признаки включают однородную бледно-желтую область в центре с белым чешуйчатым воротничком по краям. Акральная фиброкератома клинически напоминает различные другие кожные опухоли, такие как эккринная порома, пиогенная гранулема [Рисунок 10], рудиментарный добавочный палец [Рисунок 12], вирусная бородавка [Рисунок 7], дерматофиброма и кожный рог [Рисунок 13].Поэтому для окончательного диагноза требуется гистопатологический анализ, который показывает центральную область увеличенных вертикально ориентированных коллагеновых волокон с вкраплениями кровеносных сосудов, лежащих под гиперкератотическим и акантотическим эпидермисом с широкими, удлиненными, ветвящимися сетчатыми гребнями. Акральная фиброкератома и рудиментарный сверхштатный палец клинически неразличимы. Последнее, однако, является врожденным, наблюдается у основания мизинца и гистологически показывает увеличение нервных пучков в основании поражения. [61],[62],[63]

Рисунок 11: Акральная фиброкератома
Рисунок 12: Элементарная дополнительная цифра
Рисунок 13: Кожный рог

Кожный рог

Кожный рог представляет собой твердое ороговевшее роговое разрастание, обычно поражающее лицо и тыльную поверхность кистей у пожилых людей.Поражение может иметь ороговевший край у основания [Рис. 13]. Кожный рог обычно покрывает доброкачественные (себорейный кератоз, вульгарная бородавка), предраковые (актинический кератоз) или злокачественные образования (плоскоклеточный рак). Гистопатологически поражения состоят из аморфного или пластинчатого кератина с признаками основного заболевания в основании. [64],[65]

Подногтевой экзостоз

Подногтевой экзостоз обычно возникает из-под передне-медиальной области кончиков больших пальцев стопы у молодых людей.Травма является наиболее распространенным провоцирующим фактором, поэтому ранее считалось, что это реактивный доброкачественный костно-хрящевой отросток. Однако теперь он классифицируется как истинное новообразование, демонстрирующее патогномоничную транслокацию t(X; 6)(q22;q13-14). Он возникает чаще всего из гипонихия или латеральной борозды в виде фарфорово-белой твердой папулы с поверхностными телеангиэктазиями и окружающим воротничком. По мере увеличения поверхность становится гиперкератотической. Опухоль умеренно болезненная, сочетается с онихолизисом и предрасположенностью к вторичной инфекции.Рентгенологически он выглядит как трабекулярный костный нарост с увеличенной дистальной частью, покрытой рентгенопрозрачным волокнистым хрящом. Гистопатологически видна зрелая трабекулярная кость, демонстрирующая эндохондральное окостенение с пролиферирующим зрелым хрящом. Простое иссечение является излечивающим. [66],[67],[68],[69]

Эккринная порома

Эккринная порома — доброкачественная опухоль, возникающая из акросирингия. Эккринные поромы часто обнаруживаются на ладонях и подошвах и выглядят как одиночные сидячие розовато-красные папулы или узелки, часто окруженные бороздчатым воротничком из толстой кожи.Также были описаны множественные поражения, связанные с химиотерапией и трансплантацией костного мозга, а также поражения, возникающие в атипичных местах. Гистологически они состоят из пролиферирующих кубовидных клеток с выступающими ядрами и скудной цитоплазмой, демонстрирующей протоковую дифференцировку (показывающую иммуногистохимическую положительную реакцию на раково-эмбриональный антиген). Опухоль хорошо очерчена с четкой границей между поражением и прилегающим нормальным эпидермисом. Эккринные поромы часто неправильно диагностируются как акральная фиброкератома или пиогенные гранулемы из-за схожих клинических проявлений. [70],[71],[72],[73],[74],[75]

Другие заболевания

Воротник чешуйчатой ​​кожи может также наблюдаться при некоторых других нарушениях, хотя и не как характерный или постоянный признак. При определенных состояниях такой признак может быть вторичным явлением (например, воротничок чешуек, наблюдаемый при удалении очагов гипсового кератоза или образования корок при импетиго). [Таблица 2] включает такие расстройства, которые непостоянно или неспецифически проявляют шелушение воротничков в соответствии с той же категоризацией в [Таблица 1]. [14],[42],[76],[77],[78],[79],[80],[81]

Таблица 2: Дерматозы с непостоянным или неспецифическим воротничком шелушения

Финансовая поддержка и спонсорство

Нет.

Конфликт интересов

Конфликта интересов нет.

Как не быть введенным в заблуждение расстройствами, имитирующими ангионевротический отек: обзор псевдоангионевротического отека — Полный текст — Международный архив аллергии и иммунологии 2016, Vol.169, № 3

Справочная информация: Ангионевротический отек — это сосудистая реакция, затрагивающая нижние слои дермы, подкожный слой и/или подслизистую ткань и вызывающая временный локальный отек в любой части тела. Для многих медицинских работников постановка диагноза представляет собой постоянную проблему; некоторые расстройства могут проявляться подкожным или подслизистым отеком и ошибочно приниматься за ангионевротический отек. Клиницисты в отделении неотложной помощи и в клиниках иммунологии/аллергологии должны уметь распознавать признаки ангионевротического отека и проводить дифференциальную диагностику. Методы: Обзор основан на поиске литературы с определенными терминами индексации в PubMed, обзоре библиографий и клиническом опыте авторов. Результаты: Наиболее важные заболевания, имитирующие ангионевротический отек, так называемые псевдоангионевротические отеки, будут обсуждаться и иллюстрироваться клиническими фотографиями с указанием ключевых особенностей, которые помогут уточнить диагноз и отличить их от классического ангионевротического отека. Выводы: Различные дерматологические состояния могут вызывать отек, напоминающий ангионевротический отек, некоторые из которых могут привести к летальному исходу при неправильной диагностике.Информация о псевдоангионевротическом отеке имеет основополагающее значение в условиях неотложной помощи при работе с пациентами с отеком, и ее следует учитывать при оценке случая атипичного ангионевротического отека.

© 2016 S. Karger AG, Базель

Введение

Ангионевротический отек, с синонимами ангионевротический отек или отек Квинке, был первоначально описан в 1882 году немецким терапевтом и хирургом Генрихом Квинке [1]. Состояние характеризуется отеком непосредственно под поверхностью кожи и/или слизистой оболочки, вызванным внезапным увеличением проницаемости эндотелия с экстравазацией внутрисосудистой жидкости в интерстициальные ткани.Разнообразные механизмы могут запускать процесс, в результате чего ангионевротический отек можно разделить на две основные категории: наследственный и приобретенный ангионевротический отек [2,3,4]. Наследственный ангионевротический отек (НАО) представляет собой редкую форму тяжелого ангионевротического отека, вызванного генетическими мутациями в гене ингибитора комплемента С1 (C1-INH), Serping1 , что приводит к снижению уровня C1-INH. Это приводит к повторяющимся эпизодам неконтролируемой спонтанной активации контактной системы, что приводит к высвобождению мощного вазоактивного пептида, называемого брадикинином.НАО с нормальным C1-INH был в первую очередь обнаружен у женщин [5,6,7] и был описан с мутациями фактора XII (FXII-HAE) [6,8] и неизвестного происхождения. Приобретенный ангионевротический отек также может быть связан с дефицитом C1-INH, но чаще всего он опосредуется избытком локального гистамина и других вазоактивных медиаторов, высвобождаемых тучными клетками и базофилами. Причина часто бывает идиопатической, но может быть и иммунологической, например, аллергические реакции, вызванные опосредованной иммуноглобулином Е гиперчувствительностью к пищевым продуктам или лекарствам.Приобретенный ангионевротический отек также может возникать как неиммунологический побочный эффект некоторых лекарств, наиболее распространенными из которых являются сердечно-сосудистые препараты, содержащие ингибиторы ангиотензинпревращающего фермента, которые препятствуют деградации брадикинина. Цитокин-опосредованный ангионевротический отек является относительно частым осложнением лечения биологическими препаратами, особенно моноклональными антителами.

При работе в клинических условиях важно помнить, что не все опухоли являются ангионевротическим отеком. Ряд медицинских состояний может вызывать отек, напоминающий ангионевротический отек, и часто ошибочно обозначаемый как таковой из-за низкой осведомленности медицинского персонала об их типичных признаках как в условиях неотложной помощи, так и в амбулаторных условиях [9,10].Ошибочный диагноз может привести к неэффективному лечению этих потенциально серьезных состояний, поскольку большинство из них не поддаются обычному лечению ангионевротического отека, что делает правильное определение основных причин симптомов необходимым, а в некоторых случаях даже спасающим жизнь. Понимание клинических особенностей, уникальных для ангионевротического отека, а также его дифференциальной диагностики, поэтому имеет большое значение и поможет врачу определить правильную основную патофизиологию. Синдромы, которые маскируются под ангионевротический отек, в литературе называются псевдоангионевротическими и должны рассматриваться у любого пациента с атипичными проявлениями [10].В этом обзоре мы сосредоточимся на наиболее распространенных и серьезных дифференциальных диагнозах ангионевротического отека, подкрепленных иллюстративными клиническими фотографиями.

Материалы и методы

Исследования ангионевротического отека и его дифференциальной диагностики были найдены путем проведения систематического поиска литературы в PubMed (Medline) с использованием ключевых слов «ангионевротический отек», «дифференциальный диагноз», «псевдоангионевротический отек», «имитаторы ангионевротического отека», ‘острый контактный дерматит’, ‘лекарственная сыпь с эозинофилией и системными симптомами’, ‘дерматомиозит’, ‘morbus morbihan’, ‘синдром верхней полой вены’, ‘гипотиреоз’, ‘подкожная эмфизема’, ‘орофациальный гранулематоз’, ‘гипокомплементемический уртикарный васкулит ‘, ‘болезнь Кларксона’, ‘синдром Глиха’, ‘кластерная головная боль’, ‘идиопатический отек’ и комбинации этих поисковых слов.В первоначальный поиск были включены только статьи на английском языке, опубликованные с 2005 года. Общий поиск дал 14 331 совпадение, что доказывает необходимость более релевантной стратегии поиска. Поиск был ограничен полнотекстовыми статьями, которые представляли собой систематические обзоры, метаанализы, многоцентровые исследования, клинические испытания, рандомизированные клинические испытания или отчеты о случаях заболевания. С помощью этого подхода было найдено 1342 статьи. Чтобы найти оригинальные статьи и определить дополнительные соответствующие отчеты, выбранные обзоры были затем проверены на наличие соответствующих перекрестных ссылок и изучены, в результате чего появилось 4 новых оригинальных публикации.Всего по этим результатам поиска было найдено 42 статьи. Поиск прекращен 1 сентября 2015 г.

Результаты

Что такое ангионевротический отек?

Ангионевротический отек — это клинический симптом, определяемый местным отеком глубоких слоев кожи, слизистых оболочек или того и другого, включая желудочно-кишечный тракт и верхние дыхательные пути. Хотя опухоль может поражать любую часть тела, она имеет склонность к участкам с рыхлой соединительной тканью, включая лицо (особенно губы, язык и периорбитальную область), глотку, гортань, живот, гениталии и конечности [11,12, 13].Отеки проявляются рецидивирующими эпизодами выраженного локального отека с нечеткими краями. В отличие от других форм отека, ангионевротический отек не точечный, часто асимметричный и имеет тенденцию не вовлекать гравитационно-зависимые области. Кожа обычно нормального цвета, но может быть слегка эритематозной. Большинство пациентов с ангионевротическим отеком описывают покалывание, легкое онемение или даже жжение пораженного участка, при этом зуд не является типичным симптомом. Отек обычно развивается медленно в течение нескольких часов и длится менее 72 часов, исчезая спонтанно без окрашивания или шелушения кожи.Однако ангионевротический отек может иметь очень быстрое начало, если он возникает из-за анафилаксии. Более половины пациентов имеют сопутствующую крапивницу [11,12].

Псевдоангионевротический отек

Существует несколько состояний, проявляющихся подкожным отеком, которые внешне напоминают ангионевротический отек. На основании основных признаков и симптомов (онлайн-приложение, таблица 1; см. www.karger.com/doi/10.1159/000445835) эти так называемые псевдоангионевротические отеки можно клинически отличить от истинного ангионевротического отека. Ниже перечислены наиболее распространенные и важные заболевания, которые могут имитировать ангионевротический отек.

Острый контактный дерматит

Острый контактный дерматит представляет собой воспалительную реакцию кожи, вызванную контактом с инородным веществом. Реакция может быть вызвана прямым взаимодействием с раздражающим агентом (раздражающий контактный дерматит) или аллергенным химическим веществом (аллергический контактный дерматит), вызывающим аллергическую реакцию IV типа [14]. Острый контактный дерматит лица часто ошибочно принимают за ангионевротический отек, так как он может вызвать сильный отек кожи лица и периорбитальной области, особенно после контакта с краской для волос (рис.1) [14,15]. Реакция может стать настолько серьезной, что может потребоваться интубация. Его можно отличить от ангионевротического отека и других псевдоангионевротических отеков по проявлению поверхностной эритемы, дерматита, выраженной боли или зуда и анамнезу воздействия инородного вещества. Наконец, кожа часто будет шелушиться по мере разрешения отека, в отличие от пациентов с ангионевротическим отеком [14]. Антигистаминные препараты неэффективны, но симптомы реагируют на кортикостероиды, применяемые местно или системно. Диагноз подтверждается с помощью пластыря, и лечение включает в себя строгое избегание любых выявленных контактных аллергенов, а также отмену кортикостероидов после того, как симптомы хорошо контролируются.

Рис. 1

Острый контактный дерматит с сильным отеком лица после окрашивания волос.

Лекарственная сыпь с эозинофилией и системными симптомами

Лекарственная сыпь с эозинофилией и системными симптомами (DRESS) относится к редкой, но довольно тяжелой побочной кожной реакции, вызванной лекарственными препаратами. Среди широкого перечня препаратов, вызывающих эту реакцию, наиболее распространены ароматические противосудорожные препараты (фенитоин, фенобарбитал и карбамазепин) [16]. DRESS может имитировать ангионевротический отек из-за его клинических проявлений с отеком лица или более распространенным отеком, который сопровождается диффузной кореподобной сыпью (рис.2) [17]. Другие характерные признаки включают лихорадку, эозинофилию, лимфаденопатию и поражение внутренних органов, в основном печени и почек, которые отличают это состояние от ангионевротического отека. Начало заболевания обычно наблюдается в течение 6 недель после начала воздействия лекарственного средства, а DRESS имеет большую продолжительность, чем большинство аллергических реакций на лекарственные средства [16,18]. На самом деле симптомы могут даже усугубиться, несмотря на прекращение приема препарата. Таким образом, история лечения пациента вместе с объективными данными и анализами крови имеет первостепенное значение.Традиционное пластырное тестирование не может быть использовано для подтверждения диагноза, который должен быть клиническим. Лечение заключается в отмене причинного препарата. Большинство пациентов полностью выздоравливают после отмены препарата, но также широко используются схемы лечения кортикостероидами [18].

Рис. 2

Генерализованный отечный отек и кореподобная сыпь у пациента с DRESS.

Дерматомиозит

Дерматомиозит — распространенная идиопатическая воспалительная миопатия, поражающая как скелетные мышцы, так и кожу [19].Хотя этиология плохо изучена, предполагается иммунологический патогенез. Заболевание характеризуется слабостью проксимальных мышц и кожными высыпаниями в виде эритемы. Наиболее распространенные кожные проявления включают гелиотропную сыпь: характерную красновато-фиолетовую эритематозную сыпь вокруг глаз и симптом Готтрона или папулы [19,20]. Он может проявляться периорбитальным отеком, который может напоминать ангионевротический отек (рис. 3). Однако наличие симметричного проксимального миозита, кардинального мышечного признака, наряду с характерными кожными поражениями, утомляемостью, потерей веса и лихорадкой, отличают это заболевание от ангионевротического отека [11].Клиническое подозрение подтверждается биохимическими, электромиографическими и гистологическими данными о воспалении с повышением уровня креатинкиназы в сыворотке крови, антисинтетазными антителами, миопатическими признаками на электромиографии и магнитно-резонансной томографии и типичными признаками биопсии мышц или кожи, которые могут быть очаговыми. Лечение, обычно проводимое в специализированном центре, включает иммуносупрессию [21].

Рис. 3

Гелиотропная сыпь и отек и сыпь в области платка у больного дерматомиозитом.

Morbus Morbihan

Необычное кожное заболевание, называемое Morbus Morbihan, также известное как стойкий отек при розацеа, представляет собой кожное заболевание, которое можно спутать с ангионевротическим отеком [22]. Он считается редким осложнением розацеа и характеризуется стойким эритематозным отеком, ограниченным областью лба, межбровья, верхних век и щек (рис. 4). Отек нарастает постепенно, в течение месяцев или лет, с твердой консистенцией. Других симптоматических жалоб у пациента нет, специфических лабораторных и гистопатологических данных не наблюдалось [23].Хронический характер состояния кожи вместе с ограниченной локализацией должен отличать его от ангионевротического отека. Не существует руководства по его управлению. Однако сообщаемая терапия включает длительное системное применение кортикостероидов и/или пероральных антибиотиков, таких как доксициклин и изотретиноин [24].

Рис. 4

Стойкий отек лба, щек и верхних век у пациента с Morbus Morbihan.

Синдром верхней полой вены

Синдром верхней полой вены представляет собой группу симптомов, вызванных обструкцией и тем самым нарушением кровотока через верхнюю полую вену в правое предсердие.В большинстве случаев обструкция вызвана злокачественной опухолью в грудной клетке. Клинические проявления синдрома верхней полой вены обычно развиваются медленно и включают одышку, кашель и осиплость голоса. Поскольку отток крови к сердцу затруднен, синдром может на ранних стадиях маскироваться под ангионевротический отек из-за постепенного развития отека лица и верхних конечностей (рис. 5) [25,26]. Ключи для дифференциации двух диагнозов включают набухание вен на груди и шее, а также усиление симптомов, когда пациент находится в положении лежа на спине [11,27].Рентген или компьютерная томография органов грудной клетки, включая вход в грудную клетку, обычно подтверждают диагноз, после чего команда специалистов по торакальной онкологии осуществляет дальнейшее лечение.

Рис. 5

Отек лица и шеи, сопровождающийся расширением вен и цианозом, у больного с синдромом верхней полой вены. Фото предоставлено Тареком Кристофером Эль-Галали, доктором медицины, и Ниной Келдсен, доктором медицины, перепечатано с разрешения [Ugeskr Læger 2007; 169:3118].

Гипотиреоз

Недостаточная продукция тиреоидных гормонов щитовидной железой вызывает гипотиреоз, чаще всего аутоиммунный [28].Состояние проявляется широким спектром симптомов, включая увеличение веса, запор, сухость кожи, истончение волос, хриплый голос, усталость, вялость, депрессию и непереносимость холода. Тяжелый гипотиреоз может проявляться одутловатостью лица и губ, очень похожей на ангионевротический отек (рис. 6). Когда генерализованный неямочный отек (микседема) становится проявлением, периорбитальный отек часто рассматривается как симптом. Тем не менее, он не является преходящим, как ангионевротический отек [10,17]. Постановка диагноза основывается на клинических особенностях и низком уровне тиреоидных гормонов.Терапией выбора при гипотиреозе является заместительная терапия тироксином [28].

Рис. 6

Тяжелые проявления периорбитального отека у больного с гипотиреозом.

Подкожная эмфизема

Пузырьки воздуха или другие газы, попавшие в подкожные ткани, а именно подкожная эмфизема, вызывают внезапное появление отека в пораженной области [29]. Воздух может мигрировать через различные фасциальные плоскости, вовлекая грудную клетку, брюшную стенку, область промежности, конечности и чаще всего шею или лицо (рис.7), вызывая состояние, имитирующее ангионевротический отек. Воздух может попасть в ловушку в результате хирургического вмешательства или травмы, а иногда может образоваться спонтанно. Подкожная эмфизема обычно может быть диагностирована клинически по крепитации, характерному ощущению потрескивания, возникающему при проталкивании газа через ткани во время пальпации [29,30]. У пациентов с этим значимым признаком дифференциальный диагноз ангионевротического отека исключается. В сомнительных случаях можно провести рентгенографию или компьютерную томографию, чтобы проиллюстрировать наличие воздуха под поверхностью кожи и определить источник эмфиземы.

Рис. 7

Подкожная эмфизема с сильным отеком левого подбородка, век и шеи после простой стоматологической процедуры.

Орофациальный гранулематоз

Орофациальный гранулематоз представляет собой группу хронических заболеваний, поражающих мягкие ткани полости рта и челюстно-лицевой области, вторичных по отношению к основному гранулематозному воспалению [31]. Клиническая картина обычно показывает стойкий отек губ (рис. 8). Эта группа включает синдром Мелькерссона-Розенталя, идиопатическое заболевание, представленное классической триадой персистирующего отека губ или лица, паралича лицевого нерва и складчатой ​​спинки языка (lingua plicata).Моносимптомные случаи с поражением только губ называют гранулематозным хейлитом. Орофациальный отек безболезненный и асимметричный, чаще поражает верхнюю губу. Клинически он похож на ангионевротический отек и играет важную роль в качестве дифференциального диагноза [10,31,32]. Однако его хронический характер должен отличать его от типичного ангионевротического отека. Этиология остается неясной, но ее связывают с аномальной иммунной реакцией. Диагноз подтверждается гистологией. Лечение часто требует использования кортикостероидов или иммуносупрессии [32].

Рис. 8

Стойкий отек нижней губы у пациента с орофациальным гранулематозом.

Синдром гипокомплементемического уртикарного васкулита

Синдром гипокомплементемического уртикарного васкулита представляет собой форму тяжелого кожного васкулита мелких сосудов, характеризующегося крапивницей и аномально низкими уровнями комплемента C1q, C3 и C4 с антителами C1q [33,34]. Наиболее характерным проявлением этого редкого заболевания являются повторяющиеся эпизоды хронических, незудящих, уртикарных поражений кожи (рис.9) связанные с системным поражением, включая легочное заболевание, боль в животе, лейкоцитокластический васкулит, артрит, артралгию и гломерулонефрит. Необходимо исключить сопутствующее злокачественное новообразование, инфекцию или заболевание соединительной ткани. Кроме того, ангионевротический отек является начальным клиническим проявлением более чем у половины пациентов, часто вовлекая область лица и верхних конечностей — клиническая картина, которая, как оказалось, вводит в заблуждение менее опытных врачей [33,35]. Однако характерные поражения при синдроме гипокомплементарного уртикарного васкулита обычно болезненны и часто разрешаются с поствоспалительной гиперпигментацией или пурпурой после их разрешения.Эти характеристики, включая внекожное и системное поражение, нехарактерны для типичного ангионевротического отека. Соответствующее лечение определяется тяжестью заболевания и может включать комбинацию антигистаминных препаратов, гидроксихлорохина, кортикостероидов и иммуносупрессию [36].

Рис. 9

Отечные уртикарные бляшки у пациента с синдромом гипокомплементемического уртикарного васкулита.

Болезнь Кларксона

Синдром системной капиллярной утечки, также называемый болезнью Кларксона, представляет собой опасное для жизни состояние, характеризующееся повторяющимися эпизодами внезапного гиповолемического шока и массивным отеком из-за капиллярной утечки плазмы из внутрисосудистых во внесосудистые отделы [37, 38].Патогенез до сих пор не ясен, но иммунная дисрегуляция может играть существенную роль. Синдром системной капиллярной утечки диагностируется клинически после исключения других заболеваний, вызванных системной капиллярной утечкой. Диагноз ангионевротического отека следует рассматривать при первоначальном обращении. Тем не менее, в отличие от ангионевротического отека, отек кожи при синдроме системной капиллярной утечки носит генерализованный и симметричный характер (рис. 10). Более того, быстрое смещение приводит также к гиповолемии, гемоконцентрации и снижению сывороточного альбумина — триада, не характерная для ангионевротического отека.Острое лечение является поддерживающим. Сообщалось, что в некоторых случаях эффективны кортикостероиды и внутривенный иммуноглобулин [37]. Четкие стратегии профилактики не определены [38].

Рис. 10

Генерализованный отечный отек у пациента с болезнью Кларксона. Фото предоставлено: Кнуд Боннет Идерстраде, доктор медицины.

Синдром Глейха

Синдром эпизодического ангионевротического отека с эозинофилией, также известный как синдром Глейха, представляет собой редкое заболевание неясной этиологии, характеризующееся рецидивирующими эпизодами идиопатического ангионевротического отека, эозинофилии и повышением уровня иммуноглобулина в сыворотке крови, длящиеся до нескольких месяцев. 39].Клиническая картина также демонстрирует увеличение массы тела, вызванное задержкой жидкости, лихорадкой, зудом и, в некоторых случаях, крапивницей. Для синдрома характерно отсутствие поражения системных органов. Наличие специфических лабораторных признаков вместе с другими характерными клиническими проявлениями должно отличать это состояние от классического ангионевротического отека. Хотя вокруг патофизиологии ведутся споры, было описано повышение уровня интерлейкинов 5 и 6 в сыворотке [39,40].Системные кортикостероиды используются, когда требуется лечение.

Кластерная головная боль

Кластерная головная боль, также известная как гистаминовая головная боль, является редкой причиной односторонней головной или лицевой боли и периорбитального отека, часто связанного с вегетативными проявлениями, такими как инъекция конъюнктивы, птоз, сужение зрачка, слезотечение или ринит (рис. 11). При отсутствии лечения симптомы сохраняются до нескольких часов и могут повторяться. Боль обычно интенсивна и устойчива к антигистаминным препаратам и местным стероидам.Оральные стероиды приносят облегчение. Лечение эпизодов обычно проводится быстродействующими триптанами или кислородом с высокой скоростью потока. Верапамил является препаратом выбора для профилактики [41]. Наличие характерной головной боли вместе с другими клиническими проявлениями должно отличать это состояние от классического ангионевротического отека.

Рис. 11

Характерный периорбитальный отек слева и частичный птоз с инъекцией левой конъюнктивы и образованием слез во время приступа кластерной головной боли. Фото предоставлено: Horton Hovedpineforening (Датская ассоциация пациентов с кластерной головной болью), www.hortonforeningen.dk.

Идиопатический отек

Идиопатический отек — это самокупирующееся состояние стойкой задержки жидкости, в основном у женщин [3]. Задержка жидкости обычно наиболее заметна в предменструальный период, поэтому это состояние также известно как «циклический отек». Он наиболее заметен на конечностях или животе после длительного пребывания в вертикальном положении, а также в области лица, включая выраженный периорбитальный отек, после лежания в течение ночи (рис. 12). Это характерное изменение с течением времени в сочетании с чрезмерным увеличением массы тела с утра до вечера и выраженным отеком очень нехарактерно для ангионевротического отека.Кроме того, отек имеет точечный характер, в отличие от ангионевротического отека без точечной природы. Диагноз является диагнозом исключения, и его следует рассматривать только при отсутствии признаков заболевания сердца, печени, почек или щитовидной железы, которые являются хорошо известными причинами отеков. Пациенты с идиопатическими отеками часто становятся зависимыми от диуретиков, пытаясь свести к минимуму задержку жидкости. Поэтому важно избегать диуретиков и вместо этого рассматривать возможность применения ингибиторов ангиотензинпревращающего фермента при лечении этих пациентов [42].

Рис. 12

Задержка жидкости в лице у пациента с идиопатическим отеком.

Обсуждение

Различные дерматологические состояния могут вызывать отек, напоминающий диагноз ангионевротического отека. В этом обзоре обсуждаются наиболее важные заболевания, имитирующие ангионевротический отек, так называемые псевдоангионевротические отеки, а также указываются ключевые особенности, которые помогают уточнить диагноз и дифференцировать их от классического ангионевротического отека. Практические знания такого рода являются основополагающими в условиях неотложной помощи при работе с пациентами с отеком, и список заболеваний следует учитывать при оценке случая атипичного ангионевротического отека.Таким образом, можно определить первопричину симптомов, что приведет к более эффективному и адекватному лечению иногда опасных для жизни состояний.

Благодарности

Мы благодарим Тарека Кристофера Эль-Галали, доктора медицины, и Нину Келдсен, доктора медицины, за разрешение использовать рис. 5 (перепечатано с разрешения) [Ugeskr Læger 2007; разрешение использовать рисунок 10. Мы также благодарим Horton Hovedpineforening (Датская ассоциация пациентов с кластерной головной болью), www.hortonforeningen.dk за разрешение использовать рисунок 11.

Авторские права: Все права защищены. Никакая часть данной публикации не может быть переведена на другие языки, воспроизведена или использована в любой форме и любыми средствами, электронными или механическими, включая фотокопирование, запись, микрокопирование или любую систему хранения и поиска информации, без письменного разрешения издателя. .
Дозировка препарата: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор препарата и дозировка, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, в связи с продолжающимися исследованиями, изменениями в правительственных постановлениях и постоянным потоком информации, касающейся лекарственной терапии и реакций на лекарства, читателю настоятельно рекомендуется проверять вкладыш в упаковке для каждого лекарства на предмет любых изменений в показаниях и дозировке, а также для дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендуемый агент является новым и/или редко используемым лекарственным средством.
Отказ от ответственности: заявления, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и участникам, а не издателям и редакторам.Появление рекламы и/или ссылок на продукты в публикации не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор(ы) отказываются от ответственности за любой ущерб людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в содержании или рекламе.

Отслоение эпидермиса, диссоциация десмосом и дестабилизация корнеодесмосина у мышей Spink5-/-

Синдром Нетертона (NS) (MIM 256500) — тяжелое рецессивно наследуемое заболевание кожи у людей с высокой неонатальной летальностью.Он характеризуется ихтиозиформной эритродермией, атопическим дерматитом, бамбуковыми волосами, дефектами кожного барьера и повышенным уровнем IgE. у выживших (Krafchik and Toole, 1983; Judge et al., 1994). Мутации были идентифицированы в гене SPINK5 (ингибитор сериновых протеиназ Kazal типа 5) у пациентов с НС (Chavanas et al., 2000; Sprecher et al., 2001; Walley et al., 2001; Bitoun et al., 2002; Komatsu et al. 2002). SPINK5 кодирует LEKTI (лимфоэпителиальный ингибитор, родственный типу Kazal), который является предполагаемым ингибитором протеиназы, который содержит N-концевой сигнальный пептид и 15 доменов с высокой внутренней гомологией (Magert et al.1999). Каждый домен имеет четыре консервативных цистеина. Домены 2 и 15 содержат два дополнительных цистеина, что делает их типичными для Казала. домены ингибитора протеиназы (Magert et al., 1999). LEKTI проявляет активность ингибитора протеиназы in vitro (Magert et al., 1999; Komatsu et al., 2002; Walden et al., 2002; Mitsudo et al., 2003). Предполагается, что у пациентов с НС потеря или снижение активности LEKTI приводит к повышенной протеолитической активности в супрабазальном эпидермиса, что приводит к эритродермии и дефектам кожного барьера.Однако специфические белки, которые являются мишенями для деградации у этих больных не выявлено. Мы описываем здесь мутантную линию мышей Spink5 , которая демонстрирует серьезные дефекты кожи, связанные с хрупкостью десмосом, и, таким образом, дает представление о молекулярный патогенез НС и новая модельная система для изучения адгезии кератиноцитов.

Результаты и обсуждение

Трансгенная линия мышей OVE1498 была получена путем совместной инъекции меченного тирозиназой (Yokoyama et al.1990) Транспозон «Спящая красавица» (Ivics et al. 1997) (названный pT-Tybs-3′E) вместе с PGK2-SB10 (Ivics et al. 1997) (см. Дополнительный рисунок S1) в инбредных эмбрионах FVB/N. Трансгенный родоначальник и его трансгенное потомство F1 были фенотипически нормальный и не показал признаков транспозиции трансгена(ов) (данные не показаны). При скрещивании трансгенных мышей F1 Примерно у 25% новорожденных детей развились тяжелые кожные волдыри и дефекты водного барьера, что привело к смерти в течение нескольких дней. часов после рождения (рис.1А). Это наблюдение предполагает, что эта трансгенная линия несет рецессивную летальную инсерционную мутацию.

Рисунок 1.

Инсерционная инактивация гена Spink5 у мышей. ( A ) Мутантный фенотип. Типичная неонатальная гомозигота (MT) OVE1498 показана на слева . Новорожденный мутант имеет тяжелое кожное заболевание с отслоением рогового слоя и началом обезвоживания.(WT) Дикий тип однопометник. ( B ) Схематический рисунок сайта трансгенной интеграции в OVE1498. Интеграция сопровождалась делецией всех экзонов ген Spink5 на мышиной хромосоме 18. Хромосомное расположение предсказанных стартовых и стоп-кодонов mSpink5 , интеграционных соединений и ближайших вышестоящих и нижестоящих генов ( Ttid [NM_021484] и loc225443X8 [0M_] ) указаны (база данных генома мыши Ensemble).Праймеры, используемые для генотипирования, обозначены красными стрелками.

Чтобы идентифицировать трансгенный сайт интеграции, мы использовали метод обратной ПЦР (Ochman et al. 1988) для амплификации геномных последовательностей, граничащих с правым плечом трансгена с тирозиназной меткой (см. Дополнительный рисунок S2). Последовательности связаны с соответствующими трансгенами геномными последовательностями мыши из контига NT_078853 на хромосоме 18B3 (данные не показаны).Соединение между трансгенной и геномной последовательностями был расположен на 6 т.п.о. ниже стоп-кодона мышиного гена 2310065D10Rik (инвентарный номер NCBI XM_283487).

ПЦР-прогулка использовалась для идентификации другого интеграционного соединения (см. Дополнительный материал). Было обнаружено, что левое соединение быть на 3,8 т.п.н. выше стартового кодона гена 2310065D10Rik . Интеграция трансгенной ДНК сопровождалась делецией 66.8 т.п.н. в мышиной хромосоме 18, включая всю кодирующая область 2310065D10Rik , но исключая любые экзоны из предсказанных соседних генов (рис. 1В). Соседние гены ( Loc225443 и Ttid ) экспрессируются на нормальном уровне с помощью анализа ОТ-ПЦР у мутантных новорожденных (дополнительная рис. S3).

кДНК человека с наивысшей гомологией (68%) с 2310065D10Rik представляет собой кДНК SPINK5 . SPINK5 картируется на хромосоме 5q32, которая синтенична мышиной хромосоме 18B3. SPINK5 имеет 33 экзона, а 2310065D10Rik имеет 32 экзона. Положения экзон-интронных соединений хорошо сохраняются у мыши и человека (см. С4). На основании гомологии генов и сходства мутантных фенотипов мы предлагаем 2310065D10Rik и белок, кодируемый этим геном, называть Spink5 и LektI соответственно, а мы будем называть их такой.Белковая последовательность LektI на 58% идентична и на 71% гомологична человеческому. ЛЕКТИ. Два белка имеют схожую доменную организацию, включая два домена типа Kazal, домены 2 и 15 (дополнительный Рис. S4). Домен 6 LEKTI полностью отсутствует в LektI. Кроме того, между доменами 13 есть 30 дополнительных аминокислот. и 14 в LektI (дополнительный рис. S4). Мы также сравнили LektI с предполагаемым крысиным белком LektI (rLektI), который кодируется по Loc361319 (XM_341607) (дополнительный рис.С4).

Экспрессию

Spink5 в перинатальной коже анализировали с помощью ОТ-ПЦР (фиг. 2А). Экспрессия была обнаружена в пренатальной (эмбриональные дни 16,5–18,5 [E16.5–E18.5]) и неонатальной (P0) коже дикого типа (рис. 2А). Транскрипт не был амплифицирован из гомозиготной мутантной кожи. Путем гибридизации in situ транскриптов Spink5 были обнаружены специфически в верхних шиповидных и зернистых слоях кожи новорожденных (Fig. 2B). Транскрипт был также обнаружен в волосяных фолликулах кожи взрослых (рис.2Б). Этот паттерн экспрессии аналогичен описанному для человека SPINK5 (Komatsu et al. 2003).

Рисунок 2.

Анализ экспрессии Spink5 . ( A ) RT-PCR с использованием кДНК кожи дикого типа от E16.5 до P0 (дикий тип, WT) и кДНК кожи мутанта P0 (MT). HPRT использовали в качестве положительного контроля. ( B ) Гибридизация in situ на P0 дикого типа и взрослой коже.Транскрипты Spink5 обнаружены в гранулярных клетках (GR) кожи P0 и кожи взрослых, а также в волосяных фолликулах взрослых (hf). пунктирные линии указывают на границу между дермой и эпидермисом. (SC) роговой слой; (GR) зернистый слой; (SP) шиповатый слой; (BL) базальный слой; (hf) волосяной фолликул; (де) дерма. Бар, 50 мкМ.

На основе гистологических срезов оказалось, что развитие кожи у эмбрионов мышей Spink5 -/- не претерпело существенных изменений на E15.5 (данные не показаны). Однако к E17.5 роговой слой (SC) начал наблюдалось отслоение и очаговое отслоение зернистых клеток (данные не показаны). При рождении (P0) отслойка SC была широко распространен (рис. 3А). Шиповатый слой в мутантной коже оказался нормальным. Чтобы определить, вызывала ли мутация Spink5 -/- значительные изменения в экспрессии эпидермальных генов, мы проанализировали батарею маркеров дифференцировки кожи с помощью иммуногистохимия на коже P0.Кератин 14, кератин 5, кератин 1, лорикрин, филагрин, десмоглеин 1 и десмоглеин 2 (Dsg1, Dsg2) и десмоколлин 1 (Dsc1) (Cheng and Koch 2004) нормально экспрессировались в коже Spink5 -/- (данные не показаны). Экспрессия кератина 6, маркера стресса, была повышена в мутантном зернистом слое (данные не показаны). Хотя повышенная экспрессия кератина 6 может указывать на эпидермальную гиперплазию, включение BrdU было ограничено базальным кератиноцитов и встречались на сравнимых уровнях у эмбрионов Spink5 -/- (E19) и у контролей дикого типа (данные не показаны).

Рисунок 3.

Гистология и анализ эпидермального барьера на мышах Spink5 -/- . ( A ) Гистология кожи P0 Spink5 -/- (MT) и мышей дикого типа (WT). Роговой слой отслоился и не виден в мутантной коже. Кроме того, гранулированный клетки преждевременно отслаиваются от мутантной кожи (стрелки).(SC) роговой слой; (GR) зернистый слой; (SP) шиповатый слой; (BL) базальный слой; (hf) волосяной фолликул; (де) дерма. Бар, 50 мкМ. ( B ) Анализы эпидермального барьера с помощью окрашивания X-gal. Эмбрионы и новорожденные дикого типа и Spink5 -/- инкубировали с X-gal. Кожа без функционального эпидермального водного барьера окрашивается в синий цвет.

Поскольку новорожденных Spink5 -/- мышей обычно обнаруживали в виде обезвоженных трупов в течение 24 часов после рождения, мы провели анализ изменений в развитии кожного барьера. окрашиванием X-gal (Hardman et al.1998). В этой процедуре используется инкубация при кислом рН для определения эндогенной активности β-гликозидазы. На E17.5 и E19 мутантная кожа был в основном неокрашенным, что свидетельствовало о формировании кожного барьера. Тем не менее очаговое отсутствие барьерной функции (т. синее окрашивание) наблюдалось в суставных областях, таких как колени, локти, щеки и шея (рис. 3В). После рождения мыши Spink5 -/- окрашивались в синий цвет по всей поверхности тела, демонстрируя полную потерю барьерной функции (рис.3Б). Эти результаты напоминают клинические наблюдения у новорожденных с тяжелым НС, у которых преимущественно возникают кожные поражения. в суставных областях и усугубляются вскоре после рождения генерализованной эксфолиативной эритродермией (Komatsu et al., 2002; Muller et al., 2002).

Трансмиссионная электронная микроскопия образцов кожи новорожденных Spink5 -/- и однопометников дикого типа выявила аномальное ороговение у мутантных мышей (рис.4С). В частности, мы наблюдали слабо связанные между собой корнеоциты, которые содержали аномальные везикулы с низкой электронной плотностью. цитоплазма (рис. 4F), явление, наблюдаемое также в образцах NS человека (Muller et al. 2002). Кроме того, мы обнаружили отчетливую архитектурную потерю межклеточной адгезии (акантолиз) в зернистом слое мутантных клеток. эпидермис (рис. 4D). На плазматических мембранах большинства зернистых клеток были видны полудесмосомы с прикрепленными кератиновыми филаментами (рис.4Е). Этот десмосомный дефект напоминает ультраструктурные поражения, наблюдаемые на коже пациентов с листовидной пузырчаткой (ЛФ). которые страдают от надбазальных внутриэпидермальных пузырей из-за присутствия аутоантител к Dsg1 (Stanley 2000; Stanley et al. 2001).

Рисунок 4.

Трансмиссионная электронная микроскопия кожи P0 дикого типа ( A,B ) и Spink5 -/- ( C-F ).( A ) Роговой слой (SC) и зернистый слой (GR) мышей дикого типа. Зернистые клетки компактны и тесно связаны между собой. (N) ядро; (K) кератогиалиновые гранулы. ( B ) Более высокое увеличение области в рамке от A . Показаны типичные десмосомы с кератиновыми промежуточными филаментами, прикрепленными к цитоплазматической бляшке (черные стрелки). ( C ) ГР мышей Spink5 -/- . Видны отслоившиеся, не полностью ороговевшие корнеоциты (черные стрелки).Обратите внимание на акантолиз, очевидный в GR (белый стрелки). ( D ) Субкорнеальный акантолиз мышей Spink5 -/- (белая стрелка). ( E ) Более высокое увеличение области в рамке из D . На дне и крыше волдыря видны полудесмосомы с прикрепленными кератиновыми промежуточными филаментами (черные стрелки). ( F ​​ ) Spink5 -/- корнеоциты с аномальными везикулами.Бары, 2 мкм.

Сходство десмосомных дефектов у пациентов с ПФ и у мышей Spink5 -/- предполагает, что стабильность десмосомных белков может быть изменена у наших мутантных мышей. Поскольку ген Spink5 кодирует предполагаемый секретируемый ингибитор протеиназы, мы проверили увеличение активности протеиназы с помощью in situ. зимограмма (ISZ).Мутантные СК проявляли более высокую казеинолитическую активность, чем СК дикого типа, и повышенную протеиназную активность. также был обнаружен в верхних шиповатых и зернистых слоях кожи Spink5 -/- (рис. 5А). Следовательно, десмосомный дефект, наблюдаемый в мутантном эпидермисе, может быть результатом аномального повышения активности протеиназы. что приводит к преждевременной деградации внеклеточных компонентов десмосомы.

Рисунок 5.

Повышенная протеолитическая активность и деградация корнеодесмосина в коже новорожденных Spink5 -/- . ( A ) Анализ зимограммы in situ на коже P0 дикого типа (WT) и Spink5 -/- мутанта (MT) на предмет казеинолитической активности. Белые стрелки указывают на границу рогового слоя (SC) и зернистого слоя. (ГР). Фазово-контрастные изображения из тех же полей зрения показаны в нижних левых углах обоих флуоресцентных изображений.Бар, 50 мкМ. Предварительная инкубация с SBTI привела к полному отсутствию зеленой флуоресценции. как для кожи дикого типа, так и для мутантной кожи (данные не показаны). ( B ) Вестерн-блоттинг десмосомных белков из кожи P0 дикого типа (WT) и мутанта (MT). Десмоколлин1 (Dsc1) и десмоглеины 1/2 (Dsg1/2) обнаруживаются во фракции, нерастворимой в детергенте, как в коже дикого типа (WT1, WT2), так и в коже мутантов (MT1, MT2). Нет в мутантных образцах было обнаружено значительное снижение стационарного уровня любого белка.Полноразмерный корнеодесмозин Белок (Cdsn) (∼75 кДа) присутствовал в растворимой в детергенте фракции как дикого типа, так и мутантной кожи. В нерастворимом Обратите внимание на уменьшение кластера Cdsn 45-60 кДа и увеличение кластера 36-40 кДа в мутантной коже. Размеры белковых полос указаны справа . (H) Тяжелая цепь мышиного гемоглобина, которая неспецифически связывается с антителом против CDSN (Montezin et al.1997).

Основными трансмембранными десмосомными белками в верхнем шиповатом и зернистом слоях являются Dsg1 и Dsc1 (Garrod et al. 2002b). Считается, что гетерофильные взаимодействия между этими двумя типами трансмембранных гликопротеинов обеспечивают десмосомно-опосредованное взаимодействие. межклеточная адгезия (Schwarz et al. 1990; Garrod et al. 2002a,b; Cheng and Koch 2004). Еще одним внеклеточным компонентом с менее четко определенной функцией является корнеодесмозин (CDSN) (Simon et al.1997, 2001). CDSN человека представляет собой гликопротеин с молекулярной массой 52-56 кДа, экспрессируемый в верхних шиповатых и зернистых слоях нормальной кожи, а также во внутренних корневая оболочка волосяных фолликулов (Levy-Nissenbaum et al. 2003). Этот белок секретируется в межклеточное пространство и становится внеклеточным компонентом десмосом в зернистой слой и корнеодесмосомы (десмосомы, специфичные для корнеоцитов) в SC (Simon et al. 1997, 2001). Предполагается, что CDSN стабилизирует десмосомы и ковалентно связывается с ороговевающей клеточной оболочкой. (CE) (Саймон и др.1997). Кроме того, экспрессия химерного белка, состоящего из N-концевого домена CDSN и трансмембранного домена E-кадгерина способствует агрегации клеток в экспериментах по трансфекции, предполагая, что CDSN может функционировать как гомофильный молекула адгезии (Jonca et al. 2002). В нормальной коже CDSN постепенно подвергается протеолизу во время ороговения и десквамации (Simon et al. 1997, 2001). Было высказано предположение, что контролируемая деградация CDSN приводит к дестабилизации корнеодесмосом во время физиологическое шелушение (Simon et al.1997, 2001).

Чтобы определить, поражены ли Dsg1, Dsc1 или Cdsn (мышиный ортолог CDSN человека, XP_111684) в коже новорожденного Spink5 -/- , мы использовали вестерн-блоттинг с тритоном X-100 (TX 100)-растворимым и TX 100-нерастворимые белковые экстракты (фиг. 5B). Нерастворимая в TX-100 фракция содержит белки, интегрированные в зрелые десмосомы. Dsc1 и Dsg1 в основном присутствуют в нерастворимая фракция TX 100 (Pasdar and Nelson 1988).Используя антитела Dsc1 и Dsg1/2 (Cheng et al., 2004), мы не обнаружили значительного снижения стационарного уровня Dsc1 или Dsg1/2 ни в TX 100-растворимом, ни в TX 100-нерастворимые фракции кожи Spink5 -/- (рис. 5Б).

Затем мы исследовали вестерн-блоты с антителом (F28-F27), полученным против CDSN человека (Montezin et al., 1997). У людей это антитело распознает три кластера полос следующим образом: полноразмерный кластер (52-56 кДа), который в основном обнаружен в кератиносомах и присутствует в пуле, растворимом в детергенте; кластер среднего размера (40-48 кДа), который преимущественно существует во фракции, нерастворимой в детергенте, и считается, что способствует стабилизации десмосом; и небольшой кластер (33-36 кДа), который обычно присутствует в самом верхнем роговом слое и, вероятно, не обладает адгезивными свойствами (Montezin et al.1997 год; Саймон и др. 1997, 2001). В коже мыши F28-F27 также распознает три кластера Cdsn, но их размеры несколько отличаются от наблюдаемых в человека, то есть 75 кДа, 45-60 кДа и 36-40 кДа соответственно (Montezin et al. 1997). Кластер среднего размера 45-60 кДа, наблюдаемый в коже дикого типа, почти отсутствовал в коже Spink5 -/- , и вместо этого почти весь нерастворимый Cdsn имел размер 36-40 кДа, что могло быть вызвано неадекватно преждевременный протеолиз (Рис.5Б). На основании этих результатов мы предполагаем, что в отсутствие LektI преждевременный протеолиз Cdsn/CDSN у мышей Spink5 -/- мышей/пациентов с НС может в значительной степени способствовать хрупкости десмосом, отслоению эпидермиса и дефектам кожного барьера. .

Деградация CDSN

и растворение опосредованной корнеодесмосомой адгезии являются нормальными процессами в роговом слое. В нашем мышиной модели, а также у пациентов с НС человека отсутствие LektI/LEKT1 приводит к преждевременной активации вовлеченных протеиназ в этом процессе.Сериновые протеиназы SCCE (трипсиноподобный фермент рогового слоя) (Hansson et al., 1994) и SCTE (химотрипсиноподобный фермент рогового слоя) (Brattsand and Egelrud 1999), которые синтезируются в зернистых клетках и секретируются в межклеточное пространство, могут как переваривать человеческий CDSN-продуцирующий протеолитические продукты с молекулярной массой 30–33 кДа (Simon et al., 2001; Caubet et al., 2004). Они могут сотрудничать с LEKTI для регулирования стабильности CDSN в супрабазальном эпидермисе.

Мутации, приводящие к образованию укороченных форм CDSN, были описаны у людей (Levy-Nissenbaum et al.2003). Эти мутации приводят к доминантному заболеванию волос (простой гипотрихоз кожи головы), подразумевая, что CDSN играет определенную роль. в росте и поддержании волосяных фолликулов (Levy-Nissenbaum et al. 2003). До сих пор не сообщалось о гомозиготных мутантах CDSN/Cdsn у людей или мышей.

Таким образом, наши результаты показывают связь между кожными дефектами НС и нарушением функции десмосом в подкорнеальном эпидермисе, и обеспечивают возможный молекулярный механизм патогенеза НС. Spink5 -/- мышей, имитирующих тяжелую форму НС, и могут быть использованы для разработки и тестирования перинатальной терапии для лечения этого заболевания. Кроме того, наш мыши могут быть использованы для изучения созревания и стабилизации десмосом в супрабазальных слоях эпидермиса.

Материалы и методы

Генотипирование мутантного аллеля методом ПЦР

Образцы ДНК

хвоста и желточного мешка использовали в качестве ПЦР-матриц.Праймеры R3 (CCACTGGGAATGTGATGAAAGAAATAAAAGC), R-WT-s (GGCATAGTGTGTTTGGAGC), и R-WT-as (GGCATCCATTAGTTTATCTCTTACTCCAG) были разработаны на основе правого вставочного соединения (рис. 1B). R3 и R-WT-as генерируют полосу длиной 272 п.н. из мутантного аллеля. R-WT-s и R-WT-as производят полосу из 247 п.н. из дикого типа. аллель.

ОТ-ПЦР

Тотальную РНК из дикого типа и мутантной кожи спины экстрагировали с помощью набора RNeasy Mini Kit (QIAGEN).Была синтезирована первая цепь кДНК. с использованием набора для синтеза первой цепи кДНК Superscript (Invitrogen). Spink5-exon3-s (TGGTACACTGACGTGTCCCAAAG) и Spink5-exon7-as Праймеры (GGATTGGATCACTTTCCCGTGT) использовали для амплификации кДНК Spink5 размером 434 п.н. из образцов дикого типа. Использовали праймеры HPRT-s (ATGACCTAGATTGTTTTGTATACC) и HPRT-as (GTAGCTCTTCAGTCTGATAAAATCTAC). для амплификации кДНК гипоксантин-гуанинфосфорибозилтрансферазы (HPRT) в качестве положительного контроля.

Анализ эпидермальной проницаемости

Эмбрионы или новорожденные были кратко промыты 0,9% раствором NaCl и немедленно погружены в кислую смесь X-gal (100 мМ фосфатный буфер). при pH 4,3, 3 мМ K 3 Fe(CN) 6 , 3 мМ K 4 Fe(CN) 6 , 2 мМ MgCl 2 1 мг/мл X-gal), затем инкубировали в течение 8 ч при комнатной температуре в темноте (Hardman et al., 1998). Чтобы избежать повреждения неонатального эпидермиса, мы отделяли детенышей от матерей сразу после рождения.В отсутствие из зрелого эпидермального барьера X-gal проникает в клетки эпидермиса, где гидролизуется с образованием синего цвета.

Гибридизация in situ

Фрагмент кДНК Spink5 , полученный с помощью ОТ-ПЦР с праймерами Spink5-exon3-s и Spink5-exon7-as, был субклонирован в вектор pGEM-T easy. (Promega) и использовали в качестве матрицы для создания антисмыслового РНК-зонда.Дигоксигенин-UTP, РНК-полимераза T7 и Dig Nucleic Набор для обнаружения кислоты (Roche) использовали для мечения зонда и обнаружения гибридизации. (Нерадиоактивный протокол in situ описано в Интернете по адресу http://www.roche-applied-science.com/prod_inf/manuals/InSitu/pdf/ISH_149-163.pdf.)

Зимограмма in situ

BODIPYL FL казеин, конъюгат зеленого флуоресцеина (набор EnzChek Proteinase Assay Kit; Molecular Probes) использовали для зимографии in situ. (ISZ) (Kheradmand et al.2002). Вкратце, внутримолекулярно погашенный субстрат (казеин BODIPYL FL) восстанавливали в соответствии с инструкцией производителя. рекомендациям и разбавляли 1:1 в 1% агаре непосредственно перед добавлением в криостатные срезы кожи новорожденного, затем инкубацией до 24 ч при 37°С. Интенсивность флуоресценции контролировали каждые 2 часа в течение первых 10 часов, затем через 24 часа. Кожа срезы мышей дикого типа и Spink5 -/- фотографировали в равные моменты времени и время экспозиции.Для ингибирования активности сериновых протеиназ криостатные срезы кожи инкубировали со 100 мМ ингибитора трипсина сои (SBTI, Boehringer Mannheim).

Вестерн-блоты

Кожу спины

P0 измельчали ​​в жидком азоте и экстрагировали в течение 15 минут в буфер для лизиса (10 мМ Трис-Cl при рН 7,4, 5 мМ ЭДТА, 100 мМ NaCl, 1% Triton X-100 с полным коктейлем ингибиторов протеиназ от Roche).Растворимые и нерастворимые фракции были отделяют центрифугированием. Нерастворимые осадки растворяли в 5-кратном буфере Лэммли (0,05 М Tris-Cl, 4% SDS, 8% глицерин, с 20% β-меркаптоэтанола) при 100°С в течение 20 мин. Равное количество белка (определяется с помощью реагента красителя для анализа белка) от Bio-Rad) фракционировали в SDS-полиакриламидных гелях с градиентом 4–15% (Bio-Rad), затем переносили на мембраны PVDF (Bio-Rad). Использовали следующие первичные антитела: Dsg3.10 (1:800; из RDI, обнаруживает Dsg1/2), антитело Dsc1 (Cheng et al. 2004) (1:800) и антитело к корнеодесмосину F28-F27 (1:1000, от доктора Ги Серра, Университет Тулузы). III, Тулуза, Франция).

.
Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован.