Последовательность праймер база топ: Пошаговая технология нанесения гель-лака

Содержание

все от А до Я

Вы – любительница необычного, а долговечного маникюра? Любите, чтобы ноготки были идеальны без коррекции 2 -3 недели? Тогда вы точно  знаете, где в городе можно сделать маникюр по самым выгодным ценам, где работает хорошие мастера, где лучшие материалы. А особо продуманные обзавелись лампами, шеллаками, базой и топом и вовсю экспериментируют дома.
Если вы полагаете, что основа и финишное покрытие в этом деле – нюанс, которым можете пренебречь, то очень ошибаетесь. Стандартный алгоритм гласит: база и топ, а посередине шеллак. Иного не дано, сохраняется и последовательность. Иначе не только ваши труды будут напрасны – покупка лампы для полимеризации и шеллака понравившегося цвета будет пустой тратой денег. Это трио друг без друга не может  долго жить. Как же выбрать составляющие, которые определяют долговечность и защищенность ногтевой пластины и маникюра? Почему одни вам подойдут, а другие – нет, и от чего это зависит?

Базовое покрытие под гель-лак: функции, нанесение

Примем как должное, что база под пигментом должна быть всегда (кстати говоря, даже при маникюре обычным методом, обычными лаками).

Базовое средство в маникюре шеллаком необходимо для:

  • заполнения неровностей ногтя, выравнивания пластины;
  • защиты от окрашивания, проникания химического состава во время полимеризации;
  • укрепления природной пластины, укрепления свободного края;
  • сцепления ногтевой пластины с пигментированным лаком. С этой точки зрения база выступает праймером (праймер – вещество, которое готовит ноготь к нанесению лака).

А теперь поговорим простым языком о том, как правильно использовать праймер (базу), чем это сделать и какой при этом должна быть поверхность ногтя:

  1. После обычного гигиенического маникюра и коррекции свободного края сначала обязательно нужно зашлифовать пластины. Делаем это специальным шлифовщиком (по форме как обычная плоская пилка) или бафом. Причем используем самую жесткую его грань. Проходимся, в том числе по торцам. Есть места возле кутикулы, где большая по площади пилка не достает. В этом случае используем маленькую. Наша цель – не снимать верхний слой ноготка, а только лишь удалить глянец, не травмируя ногтевую пластину. Но снимать жир и глянец будем равномерно и полностью по ногтю.
  2. После убираем образовавшуюся пыль специальной щеткой или полировочной тканью.
  3. Потом обработайте ногти дезинфектором или обезжиривателем. Специальные жидкости улучшат адгезию, глубоко очистят ногти и соседние ткани. Но можете воспользоваться и обычной ЖДСЛ, которая обойдется во много раз дешевле.
  4. Если вы знаете, что плохо переносите лаковые средства (они не носятся долго, в силу физиологических особенностей отторгаются, снимаются пластами уже через неделю даже при условии правильно выполненного маникюра), можете по периметру для еще лучшей адгезии нанести небольшое количество специального праймера (жидкости водной консистенции с кисловатым насыщенным запахом, которая так и называется). Ждем высыхания такого праймера без лампы около минуты.
  5. После этого наносим праймер-базу. Тонким слоем, равномерно, не набирая много жидкости на кисть.
  6. Кисть можно брать оригинальную, которая во флаконе со средством. А можете купить кисть с длинной ручкой, сплющенную, с закругленными краями и жестким ворсом, которой пользуются профессионалы. Это, скорее, вопрос привычки.
  7. Обязательно обрабатываем торец, только не заливаем базовый состав под ноготь, а проходимся по торцу кистью с небольшим количеством средства.
  8. Такой праймер, в отличие от пигмента, стараемся намазать втирающими движениями максимально близко к кутикуле.
  9. Наносим один тонкий слой вещества, для укрепления проблемной зоны немного утолщаем его.
  10. Потом базу сушим, в среднем минуту в обычной УФ-лампе или 10 секунд в LED-лампе.
  11. Липкость не снимаем. Липкий слой служит для лучшего сцепления.

Только теперь можно наносить понравившийся цвет, отступая от кутикулы на 1 миллиметр (если вы только вникаете в этот творческий процесс, не являетесь профессионалом с поставленной к этому процессу рукой).

Все про топ-гель

Завершающим этапом маникюра (но перед нанесением ухаживающих масел) обычно есть нанесение и сушка топа.

Топ-гель (топ, финиш, финиш-гель) предназначен для:

  • Защиты слоя цветного лака от агрессивной внешней среды (моющие средства, солнце, кислые растворы).
  • Для защиты от механических повреждений, царапин, порезов;
  • Это прозрачный щит, на котором отображаются все удары, в то время как сам ноготь и цвет остаются нетронутыми.
  • Топ придает характерный блеск;
  • Топ может иметь мерцающий эффект, благодаря чему в маникюр можно добавить интересную изюминку;
  • Топом закрепляют элементы декора и дизайн. Если у вас на ногтях объемное творение искусства, можно нанести 2 слоя топ-геля.

Топ-покрытие тоже имеет особенности и четкие правила:

  1. Наносим его на липкий слой цветного покрытия.
  2. Слой топ-геля должен быть более толстым, чем праймера-базы. Но не перестарайтесь, чтобы он не оплыл на одну сторону.
  3. Запечатываем ноготь топом отжатой кистью.
  4. Покрытым и липким должен быть весь ноготь, даже труднодоступные места возле кутикул.
  5. Желательно перекрыть периметр цветного покрытия.
  6. Потом топ сушим 2 минуты или 30 секунд в LED-лампе. Если топ просушить недостаточно, маникюр быстро утратит блеск, на нем будут отпечатываться потертости и царапины, сколы на свободном крае гарантированы уже через несколько дней.
  7. Снимаем липкий слой клинсером или, как мы уже упоминали, жидкостью для снятия лака. Очень тщательно, со всех сторон и торец.
  8. На топ уже ничего не рисуем, не посыпаем, не клеим. Иногда финиш может служить липкой основой для страз, но лишь в том случае, если камень поверх не будет ничем покрываться (например, чтобы не смазать оттенок у камня).
  9. После снятия липкого слоя наносим ухаживающее и замедляющее рост кутикулы средство.

Если во время нанесения и сушки вы придерживались технологии, последовательности, то маникюр продержится пока отрастет ноготь, и не появится необходимость его коррекции из чисто эстетических соображений. К тому же натуральная ногтевая пластина будет защищена надежно, а значит, вы почувствуете еще одно важное преимущество шеллака.

Оба этих вещества прозрачные или слегка мутные, имеют немного вязкую консистенцию. В зависимости от производителя время просушки может отличаться.

Отметим, что лет 5 назад на рынке представили цветной топ-гель без дисперсионного (липкого) слоя. Однако современные однофазные гель-лаки сами по себе после помещения в УФ-лампу наделяются этими же функциями. В этом случае топ-покрытием можно пренебречь.

База и топ – защитная оболочка, которая правильно надежно охватывает и защищает декор или сплошное покрытие шеллаком, замыкая круг на кончике ногтя.

Как выбрать топ и базу

Чтобы базовый состав и финиш полностью выполняли свои функции, а значит — продлили жизнь маникюру, защитили натуральный ноготь, нужно потрудиться их правильно выбрать, в соответствии с маркой гель-лака. Если вы предпочитаете шеллак, тоже надо подобрать соответствующие средства. Вам помогут общие правила и знание нескольких нюансов:

  1. Если вы пользуетесь шеллаком, подойдет фирма Коди, Блюскай или CND – они «дружат» практически со всеми гель-лаками. Средство какой-либо другой фирмы может конфликтовать.
  2. Базу и топ предпочтительнее купить одной фирмы и соответственно гель-лак.
  3. Если вы несколько ограничены в средствах, купите цветной лак по дешевле, но на топе и базе экономить не стоит. Дело в том, что, как мы выяснили, именно они отвечают за стойкость и блеск маникюра.
  4. Мастера утверждают, что все дополнительные проверенные жидкости средней и высокой ценовой категории обладают более-менее неплохими характеристиками. Однако некоторые могут иметь дополнительные свойства. Например, иногда их обогащают гидролизированным кератином. Это даст вам преимущество в виде дополнительного ухода за пластинами и продления стойкости маникюра за счет повышенной приобретенной монолитности. В случае, если у вас тонкие ногти, подобное средство для укрепления рекомендуют наносить самостоятельно.
  5. Если пластины неровные, поврежденные, имеет смысл использовать более густую базу для лучшего укрепления.
  6. Если пластины тонкие, используем густой топ. Что касается конкретных производителей и названий продукта, то тут ориентируйтесь на то, подходит ли средство вашему гель-лаку. Это можно уточнить у продавца, на официальных сайтах, в инструкции. Более-менее универсальными считаются средства от Kodi и Блюскай.
  7. Немаловажную роль играет и удобство использования конкретного средства. Флакон должен быть удлиненным, чтобы большое количество средства не оставалось на дне из-за невозможности его быстро достать кистью. Он должен быть устойчивым. Сама кисть должна быть плотной, густой, ровно или слегка закругленно срезанной, ворсинки не должны топорщиться, ручка должна хорошо ложиться в руку. Ведь надо наносить быстро и аккуратно.

Заменить базу и топ нельзя ничем, вместо них не подойдет никакое средство, и отличаются они очень сильно, так что выбор делать придется. И не факт, что он сразу будет правильный.

В любом случае нужно проконсультироваться с мастером или грамотным продавцом, либо консультантом. Или запомните наши рекомендации и потом отправляйтесь за удачными покупками.

Базовое покрытие в маникюре — подготовка и нанесение • Журнал NAILS

Правильно нанесенное базовое покрытие является залогом успешной и длительной носки маникюра. С помощью базы можно укрепить ногти и сделать выравнивание пластин с учетом построения архитектуры. Это дает возможность получить элегантную форму и скорректировать её в местах изгибов, неровностей и пропилов, если они есть.

Подготовка

Каждому этапу предшествует подготовка. Так и с нанесением базы. Ногти необходимо правильно обработать, чтобы получить надежную сцепку и повысить прочность крепления между натуральным и искусственным слоем материала. Какие средства использовать для этого? Что является залогом успешной подготовки? Рассмотрим эти этапы в деталях.

После снятия старого покрытия, поверхности ногтевых пластин необходимо обработать бафом или аппаратным шлифовщиком, чтобы они стали ровными, однородными. Теперь приступаем к их обработке подготовительными материалами.

Этап подготовки занимает одну или две минуты, и состоит из:

  • Обезжиривания;
  • Очищения от пыли и загрязнений;
  • Дегидратация — удаления поверхностной жидкости с ногтевых пластин.

Несмотря на кажущуюся простоту, это один из основных шагов, так как от него зависит дальнейшая носка и прочность крепления базы.

Для очищения используется клинсер. Он продается как в больших емкостях по 100-250 мл, так и в баночках на 12-15 мл с кисточкой-аппликатором. Средства в больших емкостях используются и для снятия липкого слоя. Наносится с помощью безворсовой салфетки. Часто клинсер и обезжириватель – одно средство 2 в 1, на основе спирта или ацетона, которое совмещает в себе две или три функции – очищение, обезжиривание и дегидратацию. Подробнее о жидкостях для снятия покрытия.

Использование клинсера-обезжиривателя позволяет удалить пыль после опила ногтей, убрать липкость и загрязнения, а также увеличить качество сцепления поверхности ногтя с базой.

Важно хорошо проработать препаратом зону непосредственно по линии кутикулы и боковых валиков, чтобы избежать отслоек и бугристости из-за пыли или остатков спиленного птеригия.

Популярные марки обезжиривателей-дегидраторов: Kodi, InGarden, Naomi, Irisk, Patrisa Nail, Uno.

Если используются два разных состава, то после клинсера ногти обрабатываются дегидратором. Это средство высушивает поверхность ногтевой пластины, удаляя излишнюю влагу, и предотвращая этим появление отслоек материала при носке. Дегидратор наносится кисточкой-аппликатором, и необходимо дать ногтям 30 секунд, чтобы оно полностью испарилось.

Популярные марки дегидраторов: Klio, Beatrix, Neonail.

Обработка праймером

Теперь ногти рекомендуется обработать праймером для лучшего сцепления базы с ногтевой пластиной. Можно встретить другие названия праймеров: Nail Prep, бонд, супербонд, ультрабонд, бондекс у разных производителей. Иногда возникает путаница, когда в линейке одной марки есть и бонд и праймер, и тогда бонд выступает в качестве дегидратора, а праймер предназначен для улучшения адгезии.

Бонд наносится только на натуральные ногтевые пластины. Если до нанесения гель-лака было выполнено наращивание искусственных ногтей, то праймер на них наносить нет необходимости.

Праймер бывает кислотным и бескислотным. Бескислотный будет более безопасным и даст требуемый эффект. Праймер наносится только на кончики ногтей, а именно на край и стрессовую зону. Наносить его на всю ногтевую пластину также нет необходимости, иначе при нанесении базы она будет «сплывать» по нему от краев к центру.

Следи, чтобы праймер не затекал на кожу при распределении в стрессовых зонах. Он сохнет на воздухе 20-60 секунд, и далее можно приступать к нанесению базы. Некоторые праймеры необходимо сушить в лампе, поэтому лучше изучить инструкцию к средству.

Зарекомендовавшие себя марки: Fix It, Kodi, Irisk, Ibd, Grattol, Cosmoprofi, Опция, Masura, Bluesky, Rio Profi, Patrisa Nail.

Инструкция — выравниваем ноготь базой

  • Тонкое равномерное покрытие базой;
  • Выравнивание архитектуры ногтя и создание идеального блика.

О том как выбрать базовое покрытие.

Первый этап

  1. Достаем кисть из флакона базы и хорошо отжимаем её от средства с двух сторон. При этом одну сторону отжимаем полностью, до самого конца, а вторую – до того момента, пока на кончике кисточки не останется небольшая капля материала.
  2. При поднесении кисточки к ногтевой пластине, сверху материала быть не должно, он под кистью.
  3. Ставим каплю в центр ногтевой пластины и начинаем подвигать вперед, к кутикуле, оставляя небольшой отступ. Кисть должна лежать плоско по отношению к пластине на протяжении всей линии нанесения материала. Торец кисти не работает в перпендикулярном положении, только параллельно. Наносим длинным ровным движением, не мелкими штрихами. Старайся не давить сильно на кисть, чтобы не было глубоких борозд и растекания материала в стороны.
  4. Сначала промазываем середину ногтя, затем оттягиваем боковой валик, и растягивая кисть веером промазываем эту зону. Не торцом, а плоско. Повторяем, с другой стороны. Разравниваем слой по центру еще раз. Не сушим перед вторым этапом.

Второй этап

  1. Кисточку снова погружаем в базу, отжимаем полностью с одной стороны и до состояния среднего размера капли на кончике второй стороны. Ставим эту каплю у кутикулы, и кисточкой мягко разводим влево и вправо по форме буквы «Т».
  2. Кисть не отрываем, и далее тянем остаток по центральной линии до конца, создавая объем, выпуклость. Получаем форму буквы «Т». Сразу же переворачиваем ноготь вниз, чтобы «Т» не растеклась.
  3. В перевернутом состоянии проверяем, чтобы на пластине образовалась плавная дуга. Если необходимо подкорректировать, то теперь используем тонкую кисточку для рисования. Для этого весь материал снова собираем кистью в центре и заново перераспределяем по форме «Т».
  4. Получив желаемую арочную форму пластины, и проверив наличие центрального овального блика под круглой лампой, отправляем базу на полимеризацию. Работаем по очереди с каждым ногтем, меняя руки клиента, чтобы не терять время.

Если в процессе полимеризации форма немного съехала или искривилась, необходимо закончить работу со всеми ногтями, снять липкий слой и пилкой подправить архитектуру в проблемных зонах. В труднодоступных местах можно работать фрезой пламя. После этого продолжить нанесение гель-лака.

Мы уже рассказывали про нанесение базового покрытия, рекомендуем посмотреть немного другой подход:

Почему база жжет

При нанесении первого слоя полимерного покрытия у клиента возможно ощущение жжения. Чем оно вызвано?

  • Во время полимеризации базы происходит химическая реакция с интенсивным выделением тепла. Тепло расходится во все стороны, проникая и в ногтевую пластину.
  • Тонкие и пересушенные ногти более чувствительны к тепловой реакции полимера. Также стоит учитывать и исходную чувствительность ногтевых пластин.
  • Чем толще наносится слой базы, особенно при выравнивании архитектуры, тем сильнее может быть ощущение жжения.

Как избежать жжения рук в лампе

  1. Первый вариант. Разрешить клиенту вынуть руки из лампы при жжении, но обязательно перевернуть пластинами вниз, чтобы материал не растекся под кутикулу и валики, и не нарушилась архитектура. Минимальное необходимое для полимеризации верхнего слоя базы время, чтобы она «схватилась» – это 5 — 7 секунд. Вот этот диапазон лучше потерпеть максимально, а затем уже доставать руку, чтобы устранить жжение.
  2. Второй вариант. Мастеру приобрести лампу с регулируемой мощностью. Это позволит снизить интенсивность процесса полимеризации и устранить жжение.

Техника выравнивания ногтевой пластины базой может показаться трудной мастеру-новичку при первых попытках. Следует помнить, что нужна практика, что особенно актуально при работе со сложными, искривленными или волнистыми ногтями.

Комментировать

Как наносить топ и базу на ногти

Маникюр с покрытием гель-лаком подразумевает нанесение нескольких средств, среди которых, помимо цветного слоя, присутствуют база и топ. В каком порядке наносят средства на поверхность ногтевой пластины? Как правильно сделать маникюр, чтобы обеспечить максимальное сцепление покрытия и самого ногтя? Попробуем разобраться, что первое наносится – база или топ, зачем нужны эти средства и можно ли без них обойтись.

Как правильно наносить базу и зачем она нужна

Первый этап создания красивого и прочного маникюра – нанесение базы, которое следует сразу после обработки ногтевых пластин и их обезжиривания. База – прозрачный густой материал, который служит для подготовки к дальнейшему нанесению цветного лака, но не только. Использование этого средства помогает выровнять поверхность ногтевой пластины, сгладить все неровности. К тому же, база сглаживает чешуйки ногтя, проводит его запечатывание, не позволяя проникать вглубь структуры вредным веществам из лака.

База – основа под гель-лак. Она наносится первым слоем и обязательно закрепляется в ультрафиолетовой лампе до полного высушивания. Как наносить базу на ногти? Используйте те же приемы, что и при  нанесении обычного лака, стараясь покрыть средством всю поверхность ногтевой пластины.

Перед нанесением базы можно использовать праймер. Средство наносится только на самый край ногтевой пластины и стрессовую зону – ту область ногтя, которая подвергается наибольшей нагрузке при надавливании на ноготь. При полном покрытии ногтей праймером можно получить обратный ожидаемому результат – база будет стекать по ногтевой пластине к ее центральной части. Если ваши ногти прежде уже подвергались обработке праймером и сейчас вы проводите коррекцию – потребности в нанесении праймера нет.

После того, как произойдет полное затвердение базы, можно приступать к нанесению цветного покрытия. Нанесение базы на ногти – это обязательная защита, необходимая для того, чтобы не допустить попадания пигмента в ноготь и его негативного воздействия.

Когда наносить топ на ногти?

Топ или финишное покрытие – завершающий этап маникюра. Он служит для придания завершенного вида покрытым лаком ногтям. В зависимости от особенностей выбранной продукции она может придать блеск или матовость покрытию. В продаже есть топы, обеспечивающие оригинальные эффекты на ногтях.

Что первое наносится – топ или база? Топ всегда завершает маникюр. По его поверхности нельзя рисовать, она не должна содержать никаких дефектов, выпуклостей. Если при нанесении топа на кисточку попала соринка – снимите верхний слой покрытия и повторите процедуру заново. Наличие дефектов и повреждений топа может привести к нарушению эстетики маникюра,  а также – снизить его надежность. При попадании та такой ноготь воды или бытовой химии маникюр может испортиться. Топ выполняет функции обеспечения сохранности маникюра и облагораживает его.

Когда наносить топ и базу? Каждый раз, когда планируете выполнять маникюр с применением гель-лака. Эти этапы нельзя исключать из процесса, ведь отсутствие даже одного из слоев приведет к нарушению технологии и соответствующему по качеству результату.

Топ наносят и для запечатывания края ногтя. После того, как с помощью кисточки вы распределите средство по поверхности ногтевой пластины, пройдитесь ею по краю, предупреждая, таким образом, возможность проникновения внутрь влаги или других веществ. Такое запечатывание следует проводить независимо от выбора формы ногтя и его длины.

Почему важно знать, как наносить базу и топ на ногти

Задача маникюра – не просто придавать рукам красивый и ухоженный вид, но и защищать ноготки от повреждений. Применение трехслойного покрытия с базой и топом позволит решить эту задачу максимально точно и получить отличные результаты. Важно понимать ,что в составе цветного гель-лака присутствуют пигменты, которые далеко не всегда могут похвастаться полезным составом. Их проникновение в область под ногтем может привести к нарушению структуры ногтевой пластины, изменению ее цвета, появлению ломкости. База – обязательна.

Топ выполняет другие функции. Он защищает уже готовое покрытие от повреждений, обеспечивая длительный срок носки «ногтей».

Как правильно наносить базу и финиш под и на гель-лак? В этом нет никаких сложностей. Главное – тщательно обработать ноготь перед нанесением основы, зашлифовать его, удалить жир. Каждый из нанесенных слоев хорошо просушивайте в лампе – в зависимости от типа используемого средства на сушку может понадобиться разное количество минут. Топ наносится на хорошо высушенный цветной слой и декор. После его просушивания обязательно используйте масло для кутикулы и крем для рук – они помогут смягчить кожу после воздействия на нее агрессивных веществ.

Топ и база, даже при знании и соблюдении правил того, как наносить их лучше всего, будут надежны и безопасны только тогда, когда их качество не вызывает сомнений.

Всегда соблюдайте порядок нанесения средств при маникюре:

  • база отвечает за фиксацию цветного слоя на ногте и защищает сам ноготь от проникновения вредных веществ;

  • топ служит для защиты покрытия от повреждений.

Будьте внимательны и аккуратны и ваш маникюр сохранится надолго без потерь и неприятных сюрпризов. 

Топ для ногтей, топы для гель лака, для чего топ для ногтей


Особенности нанесения топа на гель-лак

Топ представляет собой финишное покрытие ногтя. Он наносится на последнем этапе выполнения маникюра. После нанесения данного покрытия ногти необходимо поместить в ультрафиолетовую лампу для высушивания и через две минуты обработать кремом или маслом (чтобы не пересушить кожу в области ногтевой пластины).

По технологии нанесения гель-лака поверх топа нельзя рисовать и красить. Его поверхность должна быть ровной, без бугорков, и если что-либо вдруг попало на кисточку или ноготь, то рекомендуется смыть топ и нанести его заново. Если этого не сделать, то ноготок будет иметь неопрятный вид или маникюр может быть испорчен, если на него попадет вода либо бытовая химия.

Нельзя забывать о запечатывании ногтя, для чего необходимо кисточкой провести по кончику ноготка и наложить немножко топа на его внутренней стороне. Таким образом, данный слой на краю ногтя обеспечивает длительную сохранность маникюра. Важную роль также играет нанесение топового слоя на краешки ногтя около кутикулы. Ведь без топа через несколько дней непокрытый гель-лак у краев потрескается.

Зачем наносить базовый слой под гель-лак

Первым этапом создания качественного маникюра с использованием гель-лака является нанесение прозрачного и густого базового слоя. С помощью базы под гель-лак выполняется выравнивание поверхности ногтя и подготовка его к покрытию выбранным лаком. Этот слой представляет собой основную ступень для выполнения стойкого и очень гладкого покрытия. Кроме осуществления функции сцепления покрытия с ногтевой пластиной, база предохраняет поверхность ногтя от воздействия ненатурального состава гель-лака, выполняет сглаживание чешуек ноготков.

База – это самый первый слой, которым необходимо покрыть ноготь перед нанесением лака и закрепить в ультрафиолетовой или светодиодной лампе. После того, как база затвердеет, осуществляется нанесение слоя гель-лака. Окончательным этапом создания маникюра является использование топа и его высушивание в особой лампе. Нанесение базового слоя выполняется на заранее обработанную ногтевую поверхность: зачищенную бафом и очищенную от жира клинсером. Для подготовки ногтевой пластинки также применяют праймер для более надежного сцепления основы с ноготком.

Базу и топ нужно наносить под гель-лак для того, чтобы обеспечить качественное сцепление ногтевой пластинки с лаком. Также данное вещество предохраняет от попадания пигмента внутрь ногтевой пластины. С его помощью успешно восстанавливается архитектура ногтевой пластины, возвращается ее первоначальный естественный вид. На обработанный базой ноготь гель-лак накладывается более гладким и ровным слоем, в результате его поверхность приобретает глянцевый блеск.

Купить топ и базу для качественного маникюра выгодно

Если Вы хотите приобрести качественные топ и базу под гель-лак для создания оригинального маникюра, то наш интернет-магазин поможет Вам сделать правильный выбор. Квалифицированные специалисты ответят на важные для Вас вопросы относительно данных товаров. У нас на сайте Вы найдете продукцию для маникюра от ведущих производителей товаров для красоты. Для заказа достаточно лишь выбрать оптимальную для Вас форму оплаты и способ доставки. Для нас нет территориальных ограничений. Мы доставим Ваш заказ в любую точку Украины.

Технология нанесения гель-лака | Отзывы покупателей

Всем привет!
После моего поста, про гель-лаки Golden Rose, меня попросили рассказать о технологии нанесения гель-лака. Если вам интересно, то прошу под кат  
Показывать нанесения гель-лака на самой себе не очень удобно и мне на помощь пришла моя любимая подруга Shella
Вот все, что мне понадобится для того, чтобы снять старый лак и сделать новый маникюр.Начну я с технологии снятия гель-лака и подготовки ногтевой пластины к нанесению нового цвета.
Для этого мне понадобится: шлифовочный баф, фольга, безворсовые салфетки, апельсиновая палочка и жидкость для снятия гель-лака.Ногтям на фото 10 дней, ногти отрасли, лак надоел и мы решили переделать маникюр.Для начала, я беру шлифовочный баф и спиливаю топовое покрытие, стразы. Делаю это для того, чтобы жидкость лучше проникла в другие слои и растворила их. Не бойтесь повредить ноготь, ведь пока есть цветной лак повредить ногтевую пластину невозможно. Можно сделать это совсем чуть-чуть, только нарушив целостность верхнего покрытия, но я спиливаю много. Так лак быстрее растворяется и легче снимается. Разрезаю фольгу на квадратики примерно 10 на 10 см. Беру безворсовые салфетки, кладу на кусочки фольги, обильно смачиваю ЖДСЛ, прикладываю к ногтю и заворачиваю на 10-15 минут. Важно смачивать безворсовую салфетку не держа в руке, а держа на фольге, тогда она вберет больше средства.ЖДСЛ у меня «Golden Rose» Studio UV Gel Nail Color Remover. Лак снимает хорошо, но очень сушит кутикулу.Затем по одному снимаю фольгу и счищаю гель-лак апельсиновой палочкой. Обязательно снимать фольгу с пальцев по очереди, иначе пока вы будете снимать гель-лак с одного ногтя он засохнет на других ногтях!Иногда остаются некоторые частички базы, которые я слегка спиливаю бафом. Вот так выглядят ногти после снятия гель-лака. Не обращайте внимание на желтый цвет ногтей. Это не вина гель-лака. Это так накосячил темно-зеленый лак от Евы. Вот и все   Снять гель-лак довольно легко. Теперь перейдем к подготовке ногтевой пластины к покрытию другим гель-лаком.Сначала делаю необрезной маникюр и подпиливаю ногти. Убираю бафом блеск. Я не спиливаю ногти а просто чуть-чуть убираю блеск. Это процедура необходима для хорошего сцепления гель-лака с ногтем.
Затем беру очищающий раствор «Golden Rose» Studio UV Gel Studio Prep& Finish Wipe-оff Solution и обезжириваю ногтевую пластину.
Чтоб гель-лак хорошо держался необходимо обеспечить идеальную сцепку с помощью праймера. Я использую праймер для гель-лака от Giorgio Capachini.
После всех манипуляций:Затем я приступаю к нанесению специальной базы. У меня это Базовое покрытие «Golden Rose» Studio UV Gel Base Coat. Очень важно наносить базу максимально тонким слоем и обязательно запечатывать торец.Сушу базу в УФ-лампе 2 минуты.У этой базы есть один ооочень существенный недостаток. Она не дружит с другими марками. В этот раз я использовала гель-лак Shellac от компании CND и через неделю лак слез пленочкой. Я проверила это и с другим цветом шеллака и с еще одной фирмой. Результат всегда один. Через 3-7 дней гель-лак слазит. При этом с лаками от ГР нет никаких проблем. Они держатся и 14, и 16 дней в идеальном состоянии.
Но это было отклонением от темы   Далее я наношу цветное покрытие. Как я уже говорила, это был черный Shellac от компании CND № 40518.Я наносила три слоя покрытия. Все слои старалась делать максимально тонкими. Это самое главное, иначе лак потечет и будут некрасивые волны. Каждый слой прослушивала в УФ-лампе в течение 2 минут. Запечатывать торец необходимо только первым слоем цветного покрытия. Если есть огрехи, убрать их надо сразу же. Пока не отправили сушить лак в лампу. Я это делаю тонкой кисточкой, смоченной в ЖДСЛ. После этого, я наношу топовое покрытие. Топовое покрытие нужно наносить очень тонким слоем и обязательно запечатывать им торец. У меня оно от фирмы Giorgio Capachini. И отправляю в лампу на 2 минуты.
Теперь осталось снять липкий слой и увлажнить кутикулу маслом… Я для этого использую очищающий раствор «Golden Rose» Studio UV Gel Studio Prep& Finish Wipe-оff Solution и безворсовую салфетку. Масло у меня вот такое. Мне очень нравится. Хорошо увлажняет, быстро впитывается и восхитительно пахнет кокосом   Вот и все. Наш маникюр готов. Мы конечно решили немного разнообразить маникюр и насыпали на не высушенное топовое покрытие золотых блесток. Но это необязательный пункт, поэтому я его описывать не стала)Я постаралась максимально подробно объяснить процесс нанесения гель-лака. Но если у вас еще остались вопросы, то задавайте. Я обязательно отвечу.
Спасибо всем кто прочитал пост.
Ко мне по прежнему на «ты».
Ваша Аня  

база или топ, чем отличаются, можно ли заменить

Маникюр – одна из первых составляющих образа красивой девушки. Вот уже несколько лет женщины всего мира отдают предпочтение гель-лаку, поскольку покрытие не поддается механическим, химическим воздействиям, носится до трех недель и выглядит эффектно. Сегодня такой маникюр можно сделать не только в салоне, но и в домашних условиях самостоятельно, но необходимо знать важные нюансы процедуры. Что наносится первым: база или топ, каковы особенности этих важных составов, являются ли они взаимозаменяемыми? Это и многое другое – в статье ниже.

Чем отличается топ от базы

Топ и база – важнейшие средства, которые наносятся на ногтевую пластину в процессе выполнения маникюра лаком на гелевой основе, обязательные элементы трехфазных покрытий. Первым ввел эти составы в использование американский бренд, ставший родоначальником гель-лаков – компания Creative Nail Design.

Важно! Пренебрегать использованием топа и базы нельзя. Покрытие, выполненное без использования первого или второго составов, не только скалывается, отслаивается и легко подвергается любым внешним воздействиям, но и вредит ногтевой пластине.

База наносится на ногтевую пластину первой, представляет собой косметический продукт, выполняющий функции:

  • обеспечение оптимального сцепления поверхности ногтевой пластины с первым слоем гель-лака;
  • предотвращение окрашивания ногтя пигментами декоративного покрытия;
  • защита ногтевой пластины от вредного воздействия лака;
  • выравнивание ногтя: первая прослойка заполняет трещинки, нивелирует бугорки;
  • бережное снятие покрытий с глиттером, блестками, камнями и другими элементами, способными травмировать ноготок;
  • обеспечение прочности;
  • выразительное раскрытие эффектов лака.

Базовый состав подразделяется:

  • по способности делать ногти прочнее – на обычный и укрепляющий;
  • по веществам в основе – классический, каучуковый, силиконовый;
  • по способности создавать декоративные эффекты – на акварельный, камуфлирующий, белый, черный.

Топ иначе называют финишем, поскольку наносится он на завершающем этапе. Функции средства:

  • защита цвета от выгорания;
  • сохранение маникюра от затирания, потери глянцевого блеска;
  • защита лака от химических (моющие, чистящие средства, стиральные порошки), механических (случайные удары) воздействий;
  • обеспечение покрытию прочности, эластичности, долговечности.

Как следует из определения первого базового и топового слоев, они отличаются по предназначению.

Важно! База и топ выполнят свои функции в том случае, если: наносятся не только на поверхность, но и на торец ногтя; используются средства одного бренда; последовательность действий соблюдена.

Что сначала наносится — топ или база

Несмотря на то, что уровень информированности среди клиенток салонов относительно маникюрных процедур растет, когда девушка первый раз покрывает гелевым средством ногти дома, все еще может возникнуть вопрос: топ или база – первый слой перед шеллаком (гель-лаком)?

Из определения и функций двух продуктов следует, что наносятся они строго в определенном порядке, менять который нельзя. Составы не взаимозаменяемы.

Первое, что необходимо знать, приступая к моделированию ногтей, это правильная очередность действий. При дизайне гель лаком сначала наносится база, потом – топ. Основа – первое, чем покрывается ногтевая пластина, второй этап – окрашивание, закрепляется результат финишем. Экспериментировать с очередностью не нужно, поскольку это может не только испортить маникюр, но и навредить ногтевой пластине.

Если по ошибке или незнанию девушка нанесла вместо базы топ первым или, наоборот, была использована база вместо топа, результат не будет долговечным, а ногтевая пластина не будет защищена должным образом.

Правила нанесения базы и топа

Основа наносится по следующим правилам:

  • первое покрытие (база) должно быть максимально тонким, чтобы не увеличивать ноготь;
  • небольшое количество геля набирают на кисточку и наносят на ногтевую пластину, начиная с середины. Основой не просто покрывают, ее как бы втирают в поверхность;
  • начальное покрытие наносится на фронтальную поверхность и на торец;
  • базу тщательно просушивают в ультрафиолетовой или LED-лампе;
  • липкий слой не снимают – он нужен для сцепления со следующим составом.

Предупреждение! Перед нанесением первого слоя (основы) ноготки подготавливают, выполняя гигиенические маникюрные процедуры: оформляют очертания, длину, убирают кутикулу, шлифуют поверхность. Производят это с целью оптимального сцепления с базой.

Девушки, делающие маникюр самостоятельно, иногда используют гель вместо базы, делая его первым слоем. Так разрешается поступать в случае, если гель может применяться в качество однофазного.

Правила нанесения финиша:

  1. Топ наносится после цветного лака.
  2. Финишный слой – более толстый, чем первый базовый.
  3. Кисть необходимо тщательно отжимать.
  4. Торец ногтя запечатывают, внимательно прокрашивая труднодоступные зоны в основании и боковые.
  5. Финишный топ хорошо просушивают в лампе, иначе маникюр быстро потеряет блеск, не будет устойчивым к внешним воздействиям.
  6. Липкий слой топа снимают специальным средством.

Внимание! После снятия липкого слоя топового покрытия, мастера ногтевого сервиса советуют наносить на кутикулу специальное масло, которое увлажнит нежную кожу, поврежденную применением подсушивающих средств.

Специалисты предупреждают, что перестановка местами этапов испортит результат. Последовательность «сначала топ, потом база» недопустима.

Выполняя маникюр гель-лаком первый раз, рекомендуется ознакомиться с обучающими видео.

Что будет, если вместо базы нанести топ

Мастера ногтевого сервиса не советуют менять местами первый и третий этапы или использовать средства, не предназначенные для того или иного действия и напоминают, что правило покрытия шеллаком – сначала база, потом топ. Такая последовательность сохраняет технологию, обеспечивает ноготкам здоровье, красивый вид.

Если нанести вместо базы топ, лак не получит необходимой степени сцепления с первым слоем, слезет с ногтя в лампе либо в процессе носки. Маникюрное средство при этом может нанести вред пластине.

Можно ли на базу наносить сразу топ

Единственное, что можно поменять в процессе выполнения маникюра гелевыми средствами – это исключить этап нанесения цветного слоя.

При желании после первой стадии можно сразу же перейти к третьей: нанести топ на базу, без удаления с основы липкого слоя.

Внимание! Перед нанесением первого (базового) слоя важно обработать ногти дегидратором и праймером.

Можно ли использовать базу вместо топа

Основа вместо финиша наноситься не может: каждое из средств имеет свои функции, для выполнения других задач не предназначено.

Результат использования базового средства вместо топового – недолговечный маникюр, подверженный выгоранию, затиранию, механическим и химическим воздействиям.

Можно ли использовать разные базу и топ

Производители гель-лаков и связанной с ними продукции рекомендуют использовать для всех трех фаз средства одной фирмы, утверждая, что гомогенность (однородность) составов обеспечивает оптимальный результат.

Практикующие мастера утверждают: если выполнена последовательность (первым наносится основа) и соблюдены все правила, то составы необязательно должны быть одной фирмы.

Плюсы и минусы базы и топа 2 в 1

С недавних пор у производителей косметических маникюрных средств в линейках появился новый вид продукта, объединяющий в себе функции базового и топового составов.

Преимущество состава 2 в 1 – отсутствие путаницы, что наносится первым и необходимости приобретения дополнительной баночки.

В качестве недостатка некоторые мастера называют то, что такое средство хуже справляется со своими задачами, нежели два отдельных продукта.

Отзывы о топе и базе два в одном

Отзывы о продукте 2 в 1 неодинаковы: одним мастерам в работе такой состав подошел, другим – нет. Ниже приведены несколько отзывов.

Анастасия, 28 лет, г. Санкт-Петербург

Шла в магазин за базой и топом Kodi. Выяснилось, что базового состава нет в наличии, есть только финишный, а мне нужны были оба. Консультант предложила средство Kodi 2 в 1. Обычно с недоверием отношусь к такого рода продуктам, но выбора не было, пришлось брать. Первый и последний раз купила состав, после работы оказалось, что опасения были не напрасны. Из минусов в процессе – слишком жидкая текстура, наносится плохо, затекает под кутикулу. По результату – в первый раз столкнулась с отслойкой. Пусть практика у меня небольшая – 1,5 года, но ранее такого не случалось. Из плюсов – удобная в работе кисточка. Обсуждала этот вопрос с соседкой, работающей в салоне, она пользовалась тем же составом. Говорит, возможно, мне попалась подделка, потому что, ранее столкнувшись с таким же коди два в одном, она была довольна, средство наносилось хорошо. Мой вывод – брать больше не буду, цена не оправдала качество.

Кристина, 34 года, г. Ставрополь

Приобрела Base Top Gel Коди, решила протестировать, чтобы сформировать свое мнение. Мне понравился и как основа, и в качестве финиша, наносится ровно. Никаких претензий ни по первому предназначению, ни по второму. Буду приобретать еще, удобно.

Виктория, 24 года, г. Витебск

Первый раз из составов два в одном пробовала Koto. Фирма не раскрученная, цена приемлемая. Для этой стоимости достойный продукт. Консистенция в меру жидкая, наносится равномерно. С ногтями, покрытыми этой основой-финишем, мои девочки ходят по 3 недели спокойно. Из минусов – не ровняет поверхность ногтя, возможно, по причине жидковатой текстуры. Из плюсов: первое – цена; большой объем, удобное нанесение, долговечность покрытия. Для беспроблемных ногтей вполне подойдет как первый и последний слой.

Заключение

На вопрос «что наносится первым: база или топ?» мастера ногтевого сервиса однозначно отвечают: база. Перестановка местами этапов работы невозможна, как и замена одного продукта другим. Качественный маникюр возможен только при условии соблюдения технологии его создания.

Топ и праймер для ногтей это одно и тоже

Последовательность нанесения гель-лака: техника нанесения базы, геля и закрепителя, время сушки, необходимые материалы и инструменты, большая палитра цветов и идеи маникюра с фото

При правильном соблюдении технологии и последовательности нанесения гель-лака ваш маникюр будет радовать вас длительное время. Но для создания идеальных красивых ноготков стоит предварительно досконально изучить информацию, если до этого вы пользовались обычными лаками для ногтей. Как и в любом деле, здесь есть свои нюансы и важные моменты, которые стоит учесть, чтобы не разочароваться в результате.

Необходимые материалы и инструменты

Многие девушки привыкли к простоте обычного лака: нанес, высушил и радуйся своему маникюру. Недостаток в том, что такая красота недолговечна в носке, особенно если вы часто занимаетесь домашними делами или чем-нибудь подобным. Потрескался, слез с кончиков ногтей — это нормальное явление.

В современной индустрии красоты появились отличные альтернативы: шеллак, гель-лак. Замечательные варианты для длительной носки и вида свежего маникюра. Но хотите длительный результат — придется и обрасти отдельной косметичкой для всех необходимых инструментов и материалов. Если не трогать пока последовательность маникюра гель-лаком, то среди ваших запасов должны присутствовать следующие наименования:

  • ножнички для кутикулы;
  • масло для кутикулы;
  • апельсиновые палочки;
  • безворсовые салфетки;
  • средство для обезжиривания ногтей;
  • основа или база под лак;
  • гель-лак нужных вам цветов;
  • топ или верхнее покрытие;
  • средство для снятия верхнего липкого слоя;
  • средство для снятия любого гель-лака и шеллака;
  • праймер и бондер по желанию;
  • любые материалы для декорирования, такие как стразы, наклейки или что-то подобное;
  • UV, LED или комбинированная лампа;
  • брусок для полировки.

В зависимости от состояния вашей кутикулы и ногтей список может варьироваться. Но основные предметы приведены выше. Существуют уже готовые в ассортименте наборы для маникюра гель-лаком.

Теперь стоит узнать об азах последовательности нанесения гель-лака в домашних условиях (ведь вам вряд ли нужна такая информация, если вы ходите в маникюрные салоны).

Почти как в строительных магазинах

Речь идет о двух бутылочках: праймер и бондер. Зачем они нужны и насколько важны? Рассмотрим все по порядку.

Праймер — средство, которое наносится на натуральный ноготь. Служит он для предварительной подготовки, словно грунтовка в ремонте перед оклейкой обоев. Праймер обезжиривает, очищает и подсушивает ногтевую пластину для лучшей сцепки с искусственным покрытием. Наносится тонким слоем и не требует отдельной сушки в лампе. Чаще всего используется в комплексе с бондером.

В свою очередь, бондер — это словно двусторонний скотч. За счет своей липкой поверхности улучшает сцепку между натуральным ногтем и искусственным покрытием. Бондер помогает избежать отслаивания лака. После нанесения сушится в лампе примерно три минуты.

С этими компонентами разобрались, теперь очередь за последовательностью нанесения гель-лака и всех составляющих.

Все шаги идеального маникюра

Покрытие ногтей гель-лаком — процедура в несколько простых этапов. Выполняя поочередно каждый шаг, вы получаете в итоге аккуратный маникюр и отличное настроение от результата своих стараний.

Вся очередность нанесения гель лака сводится к следующим этапам.

1. Обработка кутикулы и создание идеальной для вас формы ногтей пилочкой. Это достаточно важный шаг, так как от вашей тщательности и аккуратности будет зависеть внешний вид конечного результата. Не забывайте, гель-лак можно носить на ногтях около месяца. Чтобы при отрастании ногтей маникюр оставался презентабельного вида и не отслаивался, уделите достаточно внимания этому пункту.

2. Полировка специальным бруском поверхности ногтевой пластины. Это не значит, что вы спилите всю толщину ногтя, достаточно пары движений бруском. Делается это для того, чтобы лучше была сцепка натурального ногтя с искусственным покрытием.

3. Обезжиривание ногтевой пластины. Ногти, как и все наше тело, выделяют частички жира на поверхность, это естественный процесс организма. Чтобы покрытие не начало отслаиваться, не забывайте обработать каждый ноготь.

4. Нанесение праймера и естественная сушка. Об этом средстве вы уже читали выше. Если вы его приобрели, то воспользуйтесь перед очередными шагами маникюра.

5. Нанесение бондера. Как и в предыдущем пункте, повторяться не стоит. Просто воспользуйтесь и просушите в лампе достаточное время.

6. Базовое покрытие, или база. Служит преградой между живым ногтем и гель-лаком, чтобы красящий пигмент не проникал в структуру ногтевой пластины. Кроме этого, база выравнивает поверхность. Наносится на ногтевую пластину, по открытому краю ногтя запечатывается. Для идеального нанесения многие мастера пользуются дополнительно тоненькой кисточкой. Ею удобнее распределять базу для полноценного покрытия всего ногтя. Нанесли и сушите в лампе.

7. Очередь цветного гель-лака. Порядок нанесения в точности совпадает с базовым покрытием. Если вы решили сделать несколько слоев, то каждый из них сушится в лампе по отдельности.

8. Декорировать цветное покрытие можно различными способами. Отлично для этого подходят стразы, водяные, клеевые или иные наклейки, специальные клейкие ленты, блестки и много иных материалов.

9. Завершающая стадия — нанесение топового покрытия. Ничем не отличается от нанесения базы, концы ногтей точно также запечатываются. Топовое покрытие служит защитным верхним слоем от внешних воздействий и сохраняет визуальный вид маникюра идеальным долгое время. На сегодняшний день есть глянцевый и матовый топ. Достаточно популярно совмещение их для создания интересных вариантов маникюра гель-лаком.

Последовательность этих шагов приведет вас к отличному результату на долгое время.

Три вида ламп

Выбор лампы — достаточно популярный вопрос и имеет свои нюансы. Можно выделить три вида.

Во-первых, LED (или светодиодные) лампы. Компактные, легкие и долго служат, отличаются высокой скоростью полимеризации. Из минусов: некоторые виды лаков могут очень долго сушиться или не высохнут вообще.

Во-вторых, UV (или ультрафиолетовые) лампы. Стоимость значительно ниже предыдущих, но время полимеризации увеличивается.

В-третьих, гибридные лампы, совмещающие в себе положительные стороны вышеназванных агрегатов.

Еще один нюанс при выборе лампы для сушки

Отличаются лампы, помимо прочего, своей мощностью. Оптимальным вариантом для домашнего использования считаются 36 Вт. Сушка каждого слоя будет занимать примерно 2-2,5 минуты. В свою очередь, лампы 12-18 Вт будут тратить на процесс полимеризации уже порядка 3-4 минут для каждого слоя.

Вариант для новичков, чтобы не потеряться в массе бутылочек

Говоря другими словами, речь пойдет об однофазном гель-лаке. И в этом случае последовательность нанесения гель-лака сократится. Отличный вариант для тех, кто предпочитает однотонные накрашенные ногти без всякого декорирования. С другой стороны, можно и украсить, но в этом случае придется все же воспользоваться топовым покрытием для защиты украшающих элементов маникюра.

В однофазном гель-лаке совмещены и основа, или база, и пигментированный слой, и топовое покрытие. Таким образом, три различные бутылочки у вас находятся в одной. Но, как в любой бочке меда, найдется ложка дегтя. Когда вы используете все средства по отдельности, топовое покрытие создает поверхность, защищенную от внешних воздействий. В случае однофазного лака все сколы и царапины будут более видными.

Так что выбор остается за вами. В любом случае всегда можно попробовать, поэкспериментировать и выбрать наиболее оптимальный для вас вариант.

Дополнительное украшение ваших ноготков

При правильной последовательности покрытия ногтей гель-лаком ваш маникюр будет радовать долгие дни. Поэтому часто хочется чего-нибудь «этакого» для яркого акцента или оригинального вида. В качестве дополнительного декора поверхности ногтя чаще всего используют следующие материалы.

Блестящие тонкие клейкие ленты, которыми удобно создавать полосатый маникюр. Это может быть одна наклеенная линия или шеренга, переплетение полос. Удобны такие ленты тем, что имеют липкое основание, удобны в работе и отлично дополняют любой фон. Приклеиваются они на просушенный цветной слой лака и сверху покрываются слоем топа.

Стразы любых размеров и цветов. Ими можно выкладывать различные композиции, которые на солнце будут переливаться всеми цветами радуги. Некоторые мастера для надежности используют специальный клей для надежной фиксации. Несмотря на свой объемный вид, удобны в процессе носки.

Наклейки и аппликации на водяной или клеевой основе. Это отличная альтернатива рисованию кисточками. Достаточно удобно, когда за пару секунд на ногте уже готовый рисунок. Наклейки хорошего качества отличаются четкостью изображения, вплоть до реалистичного вида. Последовательность нанесения — на гель-лак и под топовое покрытие.

Трафареты под покраску, когда вы используете лак отличного от фонового цвета. Бывают многоразовые и одноразовые, но суть от этого не меняется. Вам не придется прорисовывать каждый элемент узора, тем самым вы экономите время и свои нервы.

Постоянно появляется в ассортименте что-то новое и интересное для украшения вашего маникюра. Поэтому, если вам интересна тема дизайна ногтей, старайтесь отслеживать новинки и тенденции моды.

Преимущества гель-лаков перед обычными

Даже многоэтапная последовательность нанесения гель-лака не должна отталкивать сложностью и кропотливостью, ведь конечный результат сохранится примерно на месяц. Это и есть самое главное отличие от обычных лаков.

Помимо этого, с гель-лаками удобно работать в процессе создания рисунка на ногтях. За счет того, что сохнут ногти под лампой, у вас есть достаточно времени для получения желаемого рисунка.

Также обратите внимание на неявную экономию. Ведь обычный лак хоть и стоит дешевле, но использоваться он может практически каждые два-три дня. Так что сомнительна выгода таких лаков.

После полимеризации гель-лаки более устойчивы к внешним воздействиям окружающих факторов: мытье посуды, работа в земле или иная деятельность.

Еще значительное преимущество — это способ сушки. Гель-лак после лампы уже высох, и не надо бояться вытереть его обо что-нибудь. Обычные же лаки, особенно в два или три слоя, требуют продолжительного времени для окончательного высыхания. Ведь иначе можно испортить идеальный маникюр ненужными царапинами или потертостями, нарушающими глянцевую поверхность.

Просто глаза разбегаются

От огромного ассортимента цветов и видов гель-лаков могут разбегаться глаза даже у опытной маникюрши. На сегодняшний день свою популярность заслужили следующие виды:

  • термический, когда цвет лака меняется в зависимости от температуры ногтя;
  • магнитный, за счет входящих частиц металлической стружки можно создавать эффект кошачьего глаза;
  • однотонный матовый и глянцевый, хотя чаще степень гладкости поверхности создается топовым покрытием;
  • с блестками — обычные разноцветные лаки с уже добавленными блестками.

Поэтому с таким ассортиментом можно удовлетворить даже запросы самой привередливой модницы.

Источник

Топ и праймер для ногтей это одно и тоже

Если в макияже база и праймер — это синонимы, то в маникюре — две совершенно разные вещи. Но путать их друг с другом «любителю» вовсе не критично. Праймером пользуются, как правило, профессионалы в салонах. В домашних же условиях достаточно и одной базы под цветной лак.

Прежде чем приступать к разговору, чем отличается праймер от базы для ногтей, нужно разобраться в том, что представляет собой каждый из них.

    База для ногтей с виду — обычный прозрачный лак, который, однако, играет важную роль. Он помогает подготовить ногти к нанесению цветного покрытия: разгладить их поверхность и заполнить все неровности. Поверх базы лак ложится лучше и в итоге держится дольше. Существуют базы как для обычного лакового маникюра, так и для работы с гель-лаком.

  • 6 советов, как восстановить ногти после лака

Основные различия базы для ногтей и праймера

Из текста выше ясно, что праймер и база — средства друг на друга не слишком похожие, с разным предназначением.

Если база для ногтей — это обязательное первое покрытие при создании маникюра, то праймер — это, скорее, дополнительное средство. Без праймера, в общем-то, можно и обойтись. Но профессионалы предпочитают им все-таки пользоваться.

Праймер — это, в первую очередь, средство для салонного маникюра. База используется и мастерами в салонах, и теми, кто делает маникюр самостоятельно, в домашних условиях.

Средства сильно отличаются по текстуре: у базы она тягучая, как у обычного лака для ногтей, а праймер обычно жидкий, почти как вода.

Праймер — это, с одной стороны, защита, с другой, «двухсторонний скотч» для маникюра. База же — полноценное покрытие, которое физически защищает ногти, выравнивает их поверхность, придает гладкость.

База необходима для всех видов маникюра. Праймер же используют преимущественно при наращивании ногтей, отделяя их поверхность от плотной текстуры геля.

Источник



Праймер и база – это одно и тоже?

Красивый и прочный маникюр требует использование различных средств, которые помогают укреплять ногтевую пластину, делать ее прочной, убирать лишний жировой покров. Существует праймер и база для ногтей, и многие задаются вопросом, это одно и то же или же разные средства для маникюра? Подробно разберемся в статье.

Что такое праймер?

Праймер – это средство для макияжа, маникюра или волос, которое оказывает защитную и укрепляющую функцию. Чаще всего используют праймер для лица и для ногтей, разберемся с данными понятиями более подробно, чтобы убедиться в их необходимости и эффективности.

Для лица

Праймер для лица – это специальное средство, которое может иметь светоотражающую или матовую поверхность. Макияж происходит в несколько этапов, сначала на кожу лица наносится праймер, оставляется на 20-40 секунд, после чего можно переходить к использованию тональной основы.

Праймер для лица используется не только для создания подходящей матовой поверхности кожи, но еще и для дополнительного увлажнения и защиты от воздействия негативной окружающей среды.

Для ногтей

Праймер для ногтей – это немножко другое средство, но цель использования остается одна. От праймера ногти становятся прочными, крепкими, устраняется их ломкость, повышаются сроки ношения красивого маникюра. Также праймер для ногтей способствует снятию излишней жирности поверхности ногтевой пластины, а также защищает ее от негативного воздействия самих гелей или лаков.

Многие задаются вопросом, обязательно ли пользоваться праймером для маникюра? Все мастера в один голос утверждают, что его использование обязательное, так как более плотной и достоверной защиты для ногтевой пластины не найти.

Существует множество вариантов праймеров для ногтей, но большинство мастеров по маникюру отдают предпочтение именно каучуковому варианту, который подходит под любой тип ногтя.

Что такое база?

База – это средство, которое подготавливает ногти или лицо к последующему использованию неблагоприятных средств, которые могут провоцировать аллергические реакции, пересушивать кожу и вызывать появление прыщей или раздражения. Существует много разновидностей базы под макияж или для маникюра, о лучших стоит обязательно знать. Существуют даже рейтинги, по которым можно легко определить, какой из вариантов будет лучше, а использование какого не будет представлять собой никакой ценности.

На ногти

База и праймер для ногтей – это не только защитные средства для ногтевой пластины, но еще и обеспечение полноценного цепкого контакта ногтя и гель-лака. Благодаря использованию базы, ногти на более длительное время сохраняют свою целостность, а также не оказывают негативное воздействие на саму пластину.

База характеризуется плотной консистенцией, она наносится на поверхность ногтя после праймера, хорошо распределяясь по всем уголкам пластины. После этого обязательно греется в лампе для маникюра в течение 2 минут.

Если во время сушки базы возникает ощущение жжения, стоит достать пальцы из лампы, перевернуть ладонями вверх и подождать несколько секунд. После можно продолжить сушить.

На лицо

База на лицо позволяет защитить поверхность кожи лица от сухостей, которые чаще всего провоцируют именно тональные средства, ВВ крема или пудры. База характеризуется цепкой текстурой, она легко наносится на лицо, производит легкий охлаждающий эффект, матирует лицо. Ее использование уместно только перед нанесением тональной основы.

В чём отличие праймера от базы?

Сегодня такие понятия, как база и праймер на слуху у каждой девушки. Многие используют их вместе или по отдельности, но так и не знают, чем отличается праймер от базы для ногтей или лица. Отличия у них действительно есть, и с ними нужно подробно ознакомиться предварительно.

Праймер отличается от основы под макияж или ногти практически всем! Ниже подробно разберем, в чем они заключаются.

Есть ли отличия для лица?

Давайте поговорим о разнице базы под макияж и праймера, о которых все наслышаны, и которые активно используют в процессе создания макияжа.

Праймер для лица – это довольно жидкая консистенция, которая наносится на лицо непосредственно перед макияжем для создания барьера между кожей и тональной основой. Он не имеет цвета, быстро впитывается в кожу, не оставляет на ней следов. В то время когда база для макияжа – это крем более густой консистенции, он может иметь цветовые оттенки, и используется для того, чтобы создать тональному крему, теням или пудре более насыщенный цвет, подчеркнуть черты лица. База не способна в полной мере защитить лицо, она только воздействует на цвет нанесенной косметики.

Отличия между праймером и базой колоссальные, но в то же время они выполняют одинаковые функции – используются перед созданием основного макияжа.

Подробнее об отличие и особенностях применения праймер аи базы для лица вы можете посмотреть в данном видео:

Есть ли отличия для ногтей?

Отличия есть, разберем основные:

  • Праймер для гель лака – это салонное средство, которое используется только для профессионального гель-лака. База же используется и для домашнего маникюра, даже под обычные лаки, которые не требуют сушилки в специальной лампе.
  • База – это первое покрытие для ногтя, без которого не будет происходить цепкой связи между ногтевой платиной и гель-лаком. А праймер не является обязательным для использования, избавиться от жирного слоя можно и путем небольшого спиливания верхней поверхности ногтя.
  • Стоит отметить отличия в текстуре: праймер имеет жидкую консистенцию, а база – более плотную.

Это основные отличия, на которые стоит обратить внимание перед выбором праймера или базы для ногтей.

Праймер используется только под гель-лаки или наращивание ногтей, а база может применяться для всех видов маникюра.

О применении праймера и базы для ногтей во время маникюра можно подробно посмотреть в данном видео:

Лучшие базы под тональные средства

Под тональные крема можно подобрать много различных вариантов базы, отметим лучшие в таблице:

Вариант базы Его особенности
Baby Skin Скрывает расширенные поры, делает лицо гладким и подтянутым.
Micro-Blur Skin Perfector Разравнивает и хорошо увлажняет кожу, оказывает хорошую защиту от воздействия тонального крема.
Urban Defense Характеризуется прозрачной текстурой, легко наносится, обеспечивает легкое нанесение тонального средства.
Lumi Magique Придает сияние и увлажняет кожу, осветляет и обеспечивает нанесение безопасного макияжа.
Touche Eclat Blur Primer В составе имеет мелкие блестящие частицы, делает кожу нежной и бархатистой.

Лучшие праймеры для ногтей под гель-лак

Название Эффективность
Lady Vectory Хорошо обезжиривает, предотвращает отслоение геля.
EZ Flow В продукции нет ароматизаторов, окислителей, быстро сохнет, не повреждает ноготь.
IBD Подходит для ломких ногтей, обеспечивает плотность нанесенного маникюра.
Kodi Безопасное средство плотной консистенции, идеально наносится на ногтевую пластину.

Вывод

Праймер и база – это средства для маникюра или макияжа, которые позволяют закрепить результат, подготовить ногти или кожу лица к нанесению основного средства. Отличия между ними имеются, но оба продукта в чистом виде являются необходимыми, по мнению многих мастеров.

Источник

Чем база для ногтей отличается от праймера?

Если в макияже база и праймер — это синонимы, то в маникюре — две совершенно разные вещи. Но путать их друг с другом «любителю» вовсе не критично. Праймером пользуются, как правило, профессионалы в салонах. В домашних же условиях достаточно и одной базы под цветной лак.

Прежде чем приступать к разговору, чем отличается праймер от базы для ногтей, нужно разобраться в том, что представляет собой каждый из них.

    База для ногтей с виду — обычный прозрачный лак, который, однако, играет важную роль. Он помогает подготовить ногти к нанесению цветного покрытия: разгладить их поверхность и заполнить все неровности. Поверх базы лак ложится лучше и в итоге держится дольше. Существуют базы как для обычного лакового маникюра, так и для работы с гель-лаком.

  • 6 советов, как восстановить ногти после лака

Основные различия базы для ногтей и праймера

Из текста выше ясно, что праймер и база — средства друг на друга не слишком похожие, с разным предназначением.

Если база для ногтей — это обязательное первое покрытие при создании маникюра, то праймер — это, скорее, дополнительное средство. Без праймера, в общем-то, можно и обойтись. Но профессионалы предпочитают им все-таки пользоваться.

Праймер — это, в первую очередь, средство для салонного маникюра. База используется и мастерами в салонах, и теми, кто делает маникюр самостоятельно, в домашних условиях.

Средства сильно отличаются по текстуре: у базы она тягучая, как у обычного лака для ногтей, а праймер обычно жидкий, почти как вода.

Праймер — это, с одной стороны, защита, с другой, «двухсторонний скотч» для маникюра. База же — полноценное покрытие, которое физически защищает ногти, выравнивает их поверхность, придает гладкость.

База необходима для всех видов маникюра. Праймер же используют преимущественно при наращивании ногтей, отделяя их поверхность от плотной текстуры геля.

Источник

Как разработать собственные праймеры? | Часто задаваемые вопросы о секвенировании/анализе фрагментов по Сэнгеру

Одним из наиболее важных факторов успешного автоматизированного секвенирования ДНК является правильный дизайн праймера. В этом документе описаны этапы этого процесса и основные ошибки, которых следует избегать.

**** Использование компьютера для разработки букварей ****

Мы настоятельно рекомендуем использовать компьютер во время разработки праймера, чтобы проверить наличие некоторых фатальных недостатков конструкции. Многочисленные программы способны выполнять этот анализ.Например, найдите «Primer3» в Интернете.

Некоторые основные понятия: если вас смущают нити и ориентация праймера, прочтите это.

Праймеры для секвенирования должны отжигаться с ДНК-мишенью в предсказуемом месте и на предсказуемой цепи. Кроме того, они должны быть способны к удлинению ДНК-полимеразой Taq.

Некоторые люди не понимают, как исследовать последовательность ДНК, чтобы выбрать подходящую последовательность праймера. Вот несколько вещей, которые стоит запомнить новичкам:

  • Последовательности всегда записываются от 5′ до 3′.Сюда входит последовательность вашей матричной ДНК (если она известна), последовательность векторной ДНК, в которую она встроена, и последовательность предложенных праймеров . Никогда не пишите последовательность букварей в обратном порядке, иначе вы только запутаете себя и других.
  • Полимераза всегда удлиняет 3′-конец праймера, и последовательность, которую вы прочитаете, будет той же цепью (смысловой или антисмысловой), что и сам праймер . | | БАМХИ ЭкоРИ

    Если вы клонировали интересующую вас ДНК между сайтами BamHI и EcoRI, вы можете секвенировать с помощью праймера «CTTGATGCTAGTACTACATC» (помните — это написано от 5’ до 3’), и вы получите следующую последовательность из ядра:

     TAGTGCTAGATG[your-insert-'top'-strand-Bam-to-Eco]AATCGCTGATGC...(так далее.)
     

    Что, если вместо этого вам нужна последовательность из другой нити — от Эко до Бама? В этом случае вам нужно выбрать некоторую последовательность из справа , а затем выполнить обратное дополнение перед запросом олиго. Выбираем некоторую последовательность из рисунка выше:

     CTGATGCTCATATGTTAATA
     

    Это НЕ последовательность праймеров — она дословно скопирована из приведенной выше последовательности. На самом деле, если бы вы использовали эту последовательность для праймера, секвенирование продолжалось бы на вправо, от вашей вставки .Вместо этого выполните обратное дополнение этой последовательности:

     ТАТТААКАТАГАГКАТКАГ
     

    ТЕПЕРЬ это должно произвести последовательность противоположной нити:

     CGAATT[your-insert-'bottom'-strand-Eco-to-Bam]CATCTAGCACTA...(и т.д.)
     

    Немного мелкого шрифта: лишь в редких случаях секвенирование действительно показывает нуклеотиды, расположенные сразу за праймером. В приведенных выше примерах я использовал некоторую дидактическую лицензию.


Более продвинутые концепции: как разработать праймер, который работает.

Как правило, вы начинаете с небольшого количества известной последовательности, которую хотите расширить. Вот как это сделать:

I. Разрабатывайте праймеры только на основе точных данных последовательности.
Автоматическое секвенирование (и фактически любое секвенирование) имеет конечную вероятность возникновения ошибок. Последовательность, полученная слишком далеко от праймера, должна рассматриваться как сомнительная. Чтобы определить, что «слишком далеко», мы настоятельно рекомендуем нашим клиентам прочитать памятку «Интерпретация хроматограмм секвенирования», в которой описывается, как оценивать достоверность данных, полученных от секвенаторов ABI.Выберите область для размещения праймера, где вероятность ошибки последовательности низкая.
II. Ограничьте поиск регионами, которые лучше всего отражают ваши цели.

Возможно, вы заинтересованы в максимизации полученных данных о последовательности, или вам может потребоваться изучить последовательность только в очень определенном месте в шаблоне. Такие потребности диктуют очень разные места размещения грунтовки.

  1. Максимизируйте полученную последовательность, сводя к минимуму вероятность ошибок:
    Как правило, вы должны разрабатывать праймер до 3′, насколько это возможно, если вы уверены в точности последовательности, из которой взят праймер.Праймеры на противоположные пряди следует наносить максимально в шахматном порядке.
  2. Целевое секвенирование определенной области:
    Расположите праймер так, чтобы желаемая последовательность попала в наиболее точную область хроматограммы. Данные о последовательности часто наиболее точны на расстоянии 80–150 нуклеотидов от праймера. Не рассчитывайте увидеть хорошую последовательность на расстоянии менее 50 нуклеотидов от праймера или более 300 нуклеотидов (хотя мы часто получаем последовательность, начинающуюся сразу после праймера, и часто возвращаем 700 нуклеотидов точной последовательности).
III. Найдите праймеры-кандидаты:

Идентифицируйте потенциальные праймеры для секвенирования, которые создают стабильное спаривание оснований с матричной ДНК в условиях, подходящих для циклического секвенирования. настоятельно рекомендуется использовать на этом этапе компьютер. Рекомендуемые характеристики грунтовки:

  1. Длина должна быть от 18 до 30 нуклеотидов, оптимальная 20-25 нуклеотидов. (Хотя у нас были некоторые успехи с праймерами длиннее 30 и короче 18).
  2. Желательно содержание
  3. G-C 40-60%.
  4. Tm должна быть между 55 C и 75 C. Предупреждение: старое правило «4 градуса для каждого G-C, 2 градуса для каждого AT» работает плохо, особенно для олигонуклеотидов короче 20 или длиннее 25 нт. Вместо этого попробуйте:
     Tm = 81,5 + 16,6* log[Na] + 0,41*(%GC) - 675/длина - 0,65*(%формамид) - (%несоответствие) 
IV. Откажитесь от праймеров-кандидатов, которые демонстрируют нежелательную самогибридизацию.

Праймеры, способные к самогибридизации, будут недоступны для гибридизации с матрицей.Как правило, избегайте праймеров, которые могут образовывать 4 или более последовательных связей друг с другом или всего 8 или более связей. Пример незначительно проблемного праймера:

 5'-ACGATTCATCGGACAAAGC-3'
                                                   |||| ||||
                                        3'-CGAAACAGGCTACTTAGCA-5' 

Этот олигонуклеотид образует практически стабильный димер сам с собой с четырьмя последовательными связями в двух местах и ​​всего с восемью межцепочечными связями.

Праймеры с 3′-концами, даже временно гибридизующимися, удлиняются из-за действия полимеразы, разрушая таким образом праймер и создавая ложные полосы. Будьте несколько более строгими, избегая 3′-димеров. Например, следующий праймер самодимеризуется с идеальной 3′-гибридизацией сам с собой:

 5'-CGATAGTGGGATCTAGATCCC-3'
                                                       ||||||||||||||
                                                    3'-CCCTAGATCTAGGGTGATACG-5' 

Вышеупомянутый oligo довольно плох и почти гарантированно вызовет проблемы.Обратите внимание, что полимераза будет удлинять 3′-конец во время реакции секвенирования, давая очень сильную последовательность ACTATGC. Эти полосы появятся в начале ваших «реальных» данных в виде огромных пиков, перекрывающих правильную последовательность. Большинство программ проектирования праймеров правильно обнаружат такие самодимеризующиеся праймеры и предупредят вас, чтобы вы их избегали.

Обратите внимание, однако, что ни компьютерная программа, ни эмпирическая оценка не могут точно предсказать успех или неудачу праймера. Грунтовка, которая кажется маргинальной, может работать хорошо, в то время как другая, которая кажется безупречной, может не работать вообще.Избегайте очевидных проблем, разрабатывайте лучшие праймеры, какие только можете, но в крайнем случае, если у вас мало вариантов, просто попробуйте несколько праймеров-кандидатов, независимо от потенциальных недостатков.

V. Проверьте сайт-специфичность праймера.
Выполните поиск гомологии последовательности (например, сравнение гомологии точечной диаграммы) по всем известным последовательностям матрицы, чтобы проверить наличие альтернативных сайтов праймирования. Откажитесь от любых праймеров, которые проявляют «значительную» тенденцию к связыванию с такими сайтами. Мы можем дать лишь приблизительные указания относительно того, что является «значимым».Избегайте праймеров, в которых присутствуют альтернативные сайты с (1) гомологией основного сайта более чем на 90% или (2) более чем 7 последовательными гомологичными нуклеотидами на 3′-конце или (3) количеством более чем в 5 раз превышающим предполагаемое праймирование сайт.
VI. Выбор среди кандидатов-праймеров.

Если на данный момент у вас есть несколько праймеров-кандидатов, вы можете выбрать один или несколько, которые более богаты AT на 3′-конце. По мнению некоторых исследователей, они имеют тенденцию быть немного более конкретными в действии.Вы можете использовать более одного праймера, чтобы максимизировать вероятность успеха.

Если у вас нет кандидатов, соответствующих вышеперечисленным критериям, возможно, вам придется ослабить строгость требований отбора. В конечном счете, тест хорошего праймера заключается только в его использовании, и его нельзя точно предсказать с помощью этих упрощенных эмпирических правил.

Однако, если повезет, у вас есть множество вариантов праймеров. Для проекта по сборке последовательностей разработайте больше праймеров, чем, по вашему мнению, вам действительно нужно, чтобы, даже если последовательность окажется не такой длинной, как вы надеялись, вы все равно могли получить достаточно перекрывающихся данных, чтобы гарантировать хороший консенсус по последовательности.Мы рекомендуем секвенировать обе нити для лучшего подтверждения. На одной нити разместите праймеры на расстоянии от 500 до 700 нуклеотидов (более короткий интервал безопаснее!). На противоположной нити поместите праймеры в шахматном порядке от праймеров первой нити, как показано ниже:

Дизайн грунтовки

Люди используют два основных типа праймеров:

  1. Те, которые амплифицируют ДНК
  2. Модифицирующие ДНК

 

Мы сосредоточимся на первом.Мы будем использовать белок ApoE в качестве модели. Мутации в нем являются сильным генетическим маркером болезни Альцгеймера. Мутации в этом гене происходят в аминокислотах 112 и 158. Наша цель будет состоять в том, чтобы амплифицировать этот ген и отправить его на секвенирование. Сначала мы создадим праймеры для всего гена, а затем только для важной области.

 

Сначала найдите последовательность гена, который вы хотите амплифицировать или модифицировать. Отличным местом для поиска является NCBI (http://www.ncbi.nlm.nih.gov/). Я провел поиск и нашел последовательность мРНК гена АроЕ человека (http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1). У человека около 3,2 миллиарда оснований ДНК, а это означает, что наши праймеры, вероятно, должны быть как минимум такими же сложными. Поскольку в ДНК 4 основания, сложность равна 4 степени длины. ДНК из 16 пар оснований встречается примерно 1 из 4,3 миллиардов раз(416). Обычно праймеры имеют длину от 15 до 21 пары оснований.

 

Сначала нам нужно понять, как копируется ДНК. ДНК амплифицируется от 3’-конца (произносится как Three Prime) до 5’-конца (произносится как Five Prime) копируемой цепи.Говорят, что усиление идет в направлении от 5’ к 3’.

 

Прямой праймер прост и представляет собой праймер, который находится на нижней пряди на 3′-стороне. Обратный праймер более сложен и связывается с верхней цепью на 3′-стороне.

 

 

Давайте сначала сделаем пример

Вот наша ДНК:

5’ — АТГАГГТТТГКАГГГ — 3’

       | | | | | | | | | | | | | | |

3’ — TACTCCAAACGTCGC — 5’

 

давайте сделаем гипотетические праймеры для коротких фрагментов ДНК, каждый из которых состоит из 4 оснований.

 

Прямые праймеры должны связываться с 3’-концом нижней нити, поэтому они идентичны верхней нити! Это означает, что нашим гипотетическим предварительным праймером будет ATGA. Поскольку праймеры читаются и создаются людьми, наш обратный праймер нужно писать от начала до конца. Это называется «обратным дополнением» верхней нити. 4 основания, которые связываются с 3’ верхней нитью, представляют собой TCGC. Но помните, что букварь начинается с 3′-конца, поэтому его следует читать как CGCT.Это обратное дополнение, противоположное верхней нити.

 

Глядя на последовательность ApoE, попробуйте сделать прямой и обратный праймеры из 20 оснований. Ответы ниже. http://www.ncbi.nlm.nih.gov/nuccore/FJ525876.1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

         

 

 

 

 

 

 

ApoE forward Primer:  cagcggatccttgatgctgc

Обратный праймер ApoE: aagcaccaagttcagggtgt

 

 

Мы можем использовать эти праймеры для амплификации ДНК, извлеченной из вас.Очистите его и отправьте на секвенирование. Но… .. считывания секвенирования, даже хорошие, обычно имеют длину всего около 1000 оснований, а ген > 7000 оснований.

 

Праймеры не нужно создавать только в конце ДНК, вы можете создавать их где угодно для амплификации ДНК. Теперь давайте усилим область от 112 до 158, чтобы получить более разумную последовательность.

 

Сначала давайте переведем ДНК, чтобы узнать, где эти аминокислоты расположены в ДНК, используя http://web.expasy.org/translate/ Выберите «Включить последовательность нуклеотидов». Теперь давайте поищем строку аминокислот, которые встречаются в переводе на странице NCBI «VCG». Из-за пробелов на веб-странице перевода нам нужно искать на странице «V C G». Он должен быть в 5-футовом кадре 2.

Основания в праймере не отображаются в последовательности, и обычно первые несколько оснований содержат шум, поэтому давайте создадим праймер примерно на 50-100 оснований выше VCG.

 

Я выбрал в качестве предварительного примера: gagacgcgggcacggctgtc

 

Обратный праймер должен располагаться примерно на 50-100 оснований ниже R158.Итак, давайте найдем ДНК, связанную с последовательностью VRL, которая представляет собой аминокислоты 157-159. Я выбрал эту последовательность: agcgcctggcagtgtaccag

, но это не то, что нужно для обратного дополнения.

Дополнение: tcgcggaccgtcacatggtc

Обратное дополнение: ctggtacactgccaggcgct

 

Прямые и обратные праймеры для амплификации белка ApoE, чтобы увидеть, есть ли у нас мутации, которые являются предикторами болезни Альцгеймера:

Переслать: gagacgcgggcacggctgtc

Реверс: ctggtacactgccaggcgct

 

Наконец, вы хотите найти праймеры в геноме человека, чтобы убедиться, что последовательность не повторяется где-либо еще (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

  • Использовать по одному праймеру
  • Выберите Human Genomic + Transcript для базы данных
  • Нажмите ВЗРЫВ

Похоже, ближе всего идентичность на 75%, что неплохо, но не ужасно.

 

Праймеры можно заказать в IDT: http://www.idtdna.com/site

 

Инструмент для создания праймеров

Выбор экзона/интрона Последовательность мРНК refseq в качестве ввода шаблона ПЦР требуется для опций в разделе Помощь

Последовательность мРНК refseq (например, запись последовательности entrez, номер которой начинается с NM_) позволяет программе правильно идентифицировать соответствующую геномную ДНК и, таким образом, находить правильные границы экзона/интрона.

Расстояние между экзонами PreferencePrimer не должен охватывать соединение экзон-экзон. Primer не может охватывать соединение экзон-экзон. Помощь

Это определяет, должен ли праймер охватывать соединение экзона на вашей матрице мРНК. Параметр «Праймер должен охватывать соединение экзон-экзон» указывает программе возвращать по крайней мере один праймер (в заданной паре праймеров), который охватывает соединение экзон-экзон.Это полезно для ограничения усиления только мРНК. Вы также можете исключить такие праймеры, если хотите амплифицировать мРНК, а также соответствующую геномную ДНК.

Соответствие соединения экзонов

Мин. 5′ матч Мин. 3′ матч Матч до 3 футов

Минимальное и максимальное количество оснований, которые должны отжигаться с экзонами на 5′- или 3′-стороне соединения Помощь

Это определяет минимальное количество оснований, которое праймер должен отжигать с шаблоном на 5′-стороне (т.е., к началу праймера) или к 3′-стороне (т. е. к концу праймера) экзон-экзонного соединения. Отжиг обоих экзонов необходим, так как это обеспечивает отжиг области экзон-экзонного соединения, а не только экзона. Обратите внимание, что этот параметр эффективен только в том случае, если вы выбрали «Праймер должен охватывать соединение экзон-экзон» для параметра «Промежуток соединения экзона».

Включение интрона Диапазон длины интрона Параметры проверки специфичности пары праймеров Проверка специфичности Режим поиска Автоматически с руководством пользователяБез руководства пользователя Помощь

Primer-blast пытается найти целевые праймеры, помещая праймеры-кандидаты в уникальные области матрицы, которые не похожи на другие мишени.Однако в некоторых случаях Primer-blast не может определить, является ли последовательность базы данных предполагаемой целью или нет, поэтому руководство пользователя может быть полезным (например, когда ваш шаблон представляет собой полиморфную форму или частичную область записи в поиске). базы данных или когда база данных, такая как nr, содержит избыточные записи вашего шаблона).
Параметр «Автоматически» будет запрашивать указания пользователя только в том случае, если программа не находит достаточного количества уникальных областей шаблона, в то время как параметр «Управляемый пользователем» всегда будет запрашивать указания пользователя, если ваш шаблон демонстрирует высокое сходство с любыми другими последовательностями базы данных.

База данных Репрезентативные геномы RefseqРепрезентативные геномы RefseqГеномы для выбранных организмов (только первичная эталонная сборка)РНК nrRefseq (refseq_rna)Пользовательский Помощь

Рефсек мРНК:
&nbsp&nbsp&nbsp Содержит мРНК только из коллекции эталонных последовательностей NCBI

Репрезентативные геномы Refseq:
&nbsp&nbsp&nbsp Эта база данных содержит эталонные и репрезентативные геномы NCBI RefSeq по широким таксономическим группам, включая эукариоты, бактерии, археи, вирусы и вироиды.Эти геномы являются одними из самых качественных геномов, доступных в NCBI. Эта база данных содержит минимальную избыточность в представлении генома. Для эукариот для каждого вида включен только один геном (однако при необходимости включены альтернативные локусы эукариотических геномов). Для других видов могут быть включены геномы различных изолятов одного и того же вида. Геномы митохондрий включены там, где это применимо.

Refseq РНК:
&nbsp&nbsp&nbsp Содержит все записи РНК из коллекции эталонных последовательностей NCBI

Геномы для выбранных организмов (только первичная эталонная сборка):
&nbsp&nbsp&nbspЭто полные или почти полные последовательности генома из первичных хромосомных наборов (т.е., без митохондрий или альтернативных локусов) для следующих выбранных организмов:

& NBSP & NBSP & nbspapis MELLIFERA
& NBSP & NBSP & nbspbos Taurus
& NBSP & NBSP & nbspdanio rerio
& NBSP & NBSP & nbspdog
& NBSP & NBSP & nbspdrosophila MELANOGASTER
& NBSP & NBSP & nbspgallus Gallus
& NBSP & NBSP & nbsphuman
& NBSP & NBSP & nbspmouse
& NBSP & NBSP & nbsppan троглодиты
& NBSP & NBSP & nbsppig
& NBSP & NBSP & nbsprat

Хотя последовательности в этой базе данных полностью покрыты базы данных представительные геномов RefSeq, он не содержит альтернативных локусов и, следовательно, имеет даже меньшую избыточность, чем база данных репрезентативных геномов Refseq.Эта база данных рекомендуется, если вас не беспокоит отсутствие альтернативных локусов или последовательностей митохондрий.

Пользовательский:
&nbsp&nbsp&nbspВы можете использовать свои собственные последовательности (инвентарный номер, gi или последовательность FASTA) в качестве базы данных поиска. Размер базы данных ограничен 300M.

Строгость специфичности праймера Праймер должен иметь не менее 123456 всего несоответствий по непреднамеренным целям, в том числе
по меньшей мере 123456 несоответствия в течение последнего 1 2 3456 78910111213141516171819202122 бит/с на 3′-конце. Помощь

Для этого требуется, чтобы по крайней мере один праймер (для данной пары праймеров) имел указанное количество несовпадений с непреднамеренными мишенями. Чем больше несоответствий (особенно ближе к 3′-концу) между праймерами и непреднамеренными мишенями, тем более специфична пара праймеров для вашего шаблона (т. е. будет труднее провести отжиг с непреднамеренными мишенями). Однако указание большего значения несоответствия может затруднить поиск таких конкретных праймеров.В таком случае попробуйте уменьшить значение несоответствия.


Игнорировать цели, которые 123456789 или более несовпадений с праймером. Помощь

Это еще один параметр, который можно использовать для корректировки строгости специфичности праймера. Если общее количество несовпадений между мишенью и хотя бы одним праймером (для данной пары праймеров) равно или превышает указанное число (независимо от местоположения несоответствия), то любые такие мишени будут проигнорированы при проверке специфичности праймеров.Например, если вас интересуют только мишени, идеально соответствующие праймерам, вы можете установить значение 1. Вы также можете уменьшить значение E (см. дополнительные параметры) в таком случае, чтобы ускорить поиск, поскольку высокое значение E по умолчанию не требуется для обнаружения мишеней с небольшим количеством несовпадений с праймерами.
Кроме того, эта программа имеет ограничение на обнаружение мишеней, которые слишком отличаются от праймеров… она будет обнаруживать мишени, которые имеют до 35% несовпадений с последовательностями праймеров (т. е. всего 7 несовпадений для 20-мерного).
Возможно, вам придется выбрать более чувствительные параметры взрыва (в расширенных параметрах), если вы хотите обнаруживать цели с большим количеством несоответствий, чем по умолчанию.


Максимальный размер целевого ампликона Разрешить варианты соединения

Выбор праймеров для секвенирования

Выбор праймеров для секвенирования
Последнее обновление: 15 октября 2012 г.

Стандартные грунтовки

Мы поставляем следующие стандартные праймеры (большинство 4 мкМ):
  • M13для 5′ GTAAAACGACGGCCAGT 3′
  • M13rev 5′ CACACAGGAAACAGCTATGACCAT 3′
  • 1233rev 5′ AGCGGATAACAATTTCACACAGGA 3′
  • T7long 5′ GTAATACGACTCACTATAGGGC 3′
  • T7короткий 5′ TAATACGACTCACTATAGGG 3′
  • T7term 5′ GCTAGTTATTGCTCAGCGG 3′
  • T3 5′ ААТТААКККТАКТАААГГГА 3′
  • SP6 5′ ATTTAGGTGACACTATAG 3′
  • SP6Long 5′ ATTTAGGTGACACTATAGAATAC 3′
  • BGHrev 5′ TAGAAGGCACAGTCGAGG 3′
  • pGEXFor 5′ CTGGCAAGCCACGTTTGGTG 3′
  • pGEXRev 5′ GGAGCTGCATGTGTCAGAGG 3′
  • CMVf 5′ CGCAAATGGGCGGTAGGCGTG 3′
  • pQESeqF 5′ GGCGTATCACGAGGCCCTTTCG 3′
  • pQESeqR 5′ CATTACTGGATCTATCAACAGG 3′
  • полиТ-Г 5′ TTTTTTTTTTTTTTTTTTTTTTTTTTTG 3′
  • полиТ-С 5′ TTTTTTTTTTTTTTTTTTTTTTTTTC 3′
  • полиТ-А 5′ TTTTTTTTTTTTTTTTTTTTTTTTTTTA 3′
  • полиТ(ACG) 5′ TTTTTTTTTTTTTTTTTTTTTTTTTA/C/G 3′
  • полиA-G 5′ AAAAAAAAAAAAAAAAAAAAAAAAAAAG 3′
  • полиА-С 5′ AAAAAAAAAAAAAAAAAAAAAAAAAAAC 3′
  • полиА-Т 5′ AAAAAAAAAAAAAAAAAAAAAAAAAAAT 3′
  • полиА(CGT) 5′ AAAAAAAAAAAAAAAAAAAAAAAAAC/G/T 3′

Для больших шаблонов, таких как BAC, PAC и космиды, которые могут иметь более высокие уровни примесей, мы рекомендуем использовать грунтовку SP6long вместо стандартного праймера SP6, который имеет незначительно низкую Tm.Праймер SP6long состоит из четырех оснований. длиннее (поэтому проверьте совместимость с вашими векторами), но хорошо подходит для больших шаблонов, когда более короткий Праймер SP6 не работает.

Рекомендации по дизайну грунтовки

Одним из наиболее важных факторов успешного автоматизированного секвенирования ДНК является правильное дизайн грунтовки. Важно, чтобы грунтовка обладала следующими характеристиками:
  • Температура плавления (Tm) в диапазоне от 50°С до 65°С
  • Отсутствие способности к димеризации
  • Отсутствие образования значительной шпильки (>3 п.н.)
  • Отсутствие мест вторичной заправки
  • Специфическое связывание на 3′-конце от низкого до умеренного (избегайте высокого содержания GC во избежание неправильного запуска)
Праймеры, разработанные в соответствии с этими критериями, обычно имеют длину от 18 до 30 оснований. и иметь %GC от 40 до 60.Старайтесь избегать использования праймеров с Tm выше 65-70°С, особенно на высоких GC. шаблоны, так как это может привести к вторичным артефактам прайминга и зашумленным последовательностям. Мы настоятельно рекомендуем использовать компьютерное программное обеспечение для разработки праймеров с этими характеристики. Примеры такого программного обеспечения: LaserGene (DNAStar), Oligo (National Biosciences, Inc.), MacVector (Kodak/IBI) и пакет GCG. Кроме того, есть веб-сайт доступны для разработки праймеров для ПЦР с помощью программы Primer.Вместо программного обеспечения для грубой оценки Tm можно использовать следующее уравнение:
    Tm = 59,9 + 0,41*(%GC) - 600/длина
 
При разработке праймера на основе существующих данных секвенирования выберите сайт праймирования, размер которого превышает 50 нуклеотидов от положения, в котором требуется новая последовательность. Избегайте разработки праймеров с использованием области последовательности более низкого качества, такие как области за пределами разрешения одного пика хроматограммы (обычно 600-700 оснований). Избегайте праймеров там, где альтернативные сайты праймеров присутствуют с более чем 90% идентичностью с основным сайтом или совпадают более чем с семью последовательные нуклеотиды на 3′-конце.

Наконец, имейте в виду, что ни один набор рекомендаций не всегда точно предскажет успех праймера. Некоторые праймеры могут не работать без видимых причин, а праймеры, которые кажутся плохими кандидатами, могут работать хорошо.

Addgene: Protocol — Как разработать праймеры

Дизайн праймеров для ПЦР

Олигонуклеотидные праймеры необходимы при проведении реакции ПЦР. Необходимо разработать праймеры, комплементарные матричной области ДНК. Они синтезируются химически путем соединения нуклеотидов вместе.Нужно избирательно блокировать и повторно блокировать реактивные группы на нуклеотиде при добавлении нуклеотида по одному. Основное свойство праймеров состоит в том, что они должны соответствовать последовательностям молекулы-матрицы (должны быть комплементарны цепи матрицы). Однако праймеры не обязательно должны полностью соответствовать цепи матрицы; однако важно, чтобы 3′-конец праймера полностью соответствовал цепи матричной ДНК, чтобы можно было продолжить удлинение. Обычно на 3′-конце используется гуанин или цитозин, а 5′-конец праймера обычно имеет участки в несколько нуклеотидов.Кроме того, оба 3′-конца гибридизированных праймеров должны указывать друг на друга.

Размер грунтовки также очень важен. Короткие праймеры в основном используются для амплификации небольшого простого фрагмента ДНК. С другой стороны, длинный праймер используется для амплификации образца геномной ДНК эукариот. Однако праймер не должен быть слишком длинным (> 30-мерных праймеров) или слишком коротким. Короткие праймеры дают неточный, неспецифический продукт амплификации ДНК, а длинные праймеры приводят к более медленной скорости гибридизации.В среднем фрагмент ДНК, который необходимо амплифицировать, должен иметь размер в пределах 1-10 кБ.

Структура грунтовки должна быть относительно простой и не содержать внутренней вторичной структуры во избежание внутренней складчатости. Также необходимо избегать отжига праймеров, который создает димеры праймеров и нарушает процесс амплификации. При разработке, если вы не знаете, какой нуклеотид поместить в определенное положение внутри праймера, можно включить более одного нуклеотида в это положение, называемое смешанным сайтом.Можно также использовать молекулярную вставку на основе нуклеотидов (инозин) вместо обычного нуклеотида для более широких возможностей спаривания.

Принимая во внимание приведенную выше информацию, грунтовки обычно должны обладать следующими свойствами:

  • Длина 18-24 основания
  • Содержание 40-60% G/C
  • Начало и конец с 1-2 парами G/C
  • Температура плавления (Tпл) 50-60°С
  • Пары праймеров должны иметь Tm в пределах 5°C друг от друга
  • Пары праймеров не должны иметь комплементарных областей

    Примечание: Если вы будете включать сайт рестрикции на 5’-конце вашего праймера, обратите внимание, что перед ним следует добавить «зажим» из 3–6 пар оснований, чтобы фермент мог эффективно расщеплять (например,грамм. GCGGCG-сайт рестрикции-ваша последовательность).

PCR Primer Дизайн Советы — За Bench

Выберите страну / регион *

Выберите страну / regionUnited StatesCanadaAfghanistanAlbaniaAlgeriaAmerican SamoaAndorraAngolaAnguillaAntarcticaAntigua и BarbudaArgentinaArmeniaArubaAustraliaAustriaAzerbaijanBahamasBahrainBangladeshBarbadosBelarusBelgiumBelizeBeninBermudaBhutanBoliviaBosnia и HerzegovinaBotswanaBouvet IslandBrazilBritish Индийский океан TerritoryBrunei DarussalamBulgariaBurkina FasoBurundiCambodiaCameroonCape VerdeCayman IslandsCentral африканских RepublicChadChileChinaChristmas IslandCocos (Килинг) IslandsColombiaComorosCongoCongo, Демократическая Республика ofCook IslandsCosta RicaCote Д’ИвуарХорватияКубаКипрЧехияДанияДжибутиДоминикаДоминиканская РеспубликаВосточный ТиморЭквадорЕгипетСальвадорЭкваториальная ГвинеяЭритреяЭстонияЭфиопияФолклендские (Мальвинские) островаФарерские островаФиджиФинляндияФранцияФранцузская ГвианаФранцузская ПолинезияФранцузские Южные ТерриторииГабонГамбияГрузияГерманияГерманияG reeceGreenlandGrenadaGuadeloupeGuamGuatemalaGuineaGuinea-BissauGuyanaHaitiHeard и McDonald IslandsHoly Престол (Ватикан) HondurasHong KongHungaryIcelandIndiaIndonesiaIran (Исламская Республика) IraqIrelandIsraelItalyJamaicaJapanJordanKazakstanKenyaKiribatiKorea, Корейские Народно-Демократической RepKorea, Республика ofKuwaitKyrgyzstanLao Народный Демократической RepLatviaLebanonLesothoLiberiaLibyan Arab JamahiriyaLiechtensteinLithuaniaLuxembourgMacauMadagascarMalawiMalaysiaMaldivesMaliMaltaMarshall IslandsMartiniqueMauritaniaMauritiusMayotteMexicoMicronesia, Федеративные StatesMoldova, Республика ofMonacoMongoliaMontserratMoroccoMozambiqueMyanmarNamibiaNauruNepalNetherlandsNetherlands AntillesNew CaledoniaNew ZealandNicaraguaNigerNigeriaNiueNorfolk IslandNorthern Mariana IslandsNorwayOmanPakistanPalauPanamaPapua Нового GuineaParaguayPeruPhilippinesPitcairnPolandPortugalPuerto RicoQatarReunionRomaniaRussian FederationRwandaSaint HelenaSaint Китс и НевисСент-ЛюсияСент-Пьер и МикелонСамоаСан-МариноСао Том и PrincipeSaudi ArabiaSenegalSeychellesSierra LeoneSingaporeSlovakiaSloveniaSolomon IslandsSomaliaSouth AfricaSpainSri LankaSth Georgia & Sth Sandwich Институт социальный Винсент и GrenadinesSudanSurinameSvalbard и Ян MayenSwazilandSwedenSwitzerlandSyrian Arab RepublicTaiwan, провинция ChinaTajikistanTanzania, Объединенная Республика ofThailandTogoTokelauTongaTrinidad и TobagoTunisiaTurkeyTurkmenistanTurks и Кайкос IslandsTuvaluUgandaUkraineUnited Арабского EmiratesUnited KingdomUruguayUS Малого отдаленное IslandsUzbekistanVanuatuVenezuelaVietnamVirgin остров (Британский) Виргинские острова (U.S.)Острова Уоллис и ФутунаЗападная СахараЙеменЮгославияЗамбияЗимбабве

Как создавать грунтовки | Бенчлинг

Дизайн праймера с использованием инструментов молекулярной биологии Benchling

Дизайн

Primer может показаться простым; в конце концов, праймеры имеют длину менее 30 пар оснований! Но с таким количеством чувствительных характеристик праймеров, которые необходимо учитывать, наряду с огромным объемом праймеров, которые может потребоваться создать исследователю, может быть сложно поддерживать организованность и отслеживаемость процесса.

Приложение

Benchling для молекулярной биологии позволяет создавать интеллектуальные праймеры вручную или автоматически с помощью мастера. С помощью интеллектуальных систем разрешений вы можете указать, какие команды имеют доступ к тем или иным проектам. Затем команды могут сохранять учебники для начинающих в пользовательских или общих библиотеках для дальнейшего использования или дальнейшего сотрудничества и разработки. В инструменте праймеров Benchling сканирует и обнаруживает сайты связывания в последовательностях, что позволяет точно прикреплять праймеры, проводить ПЦР в силико и использовать продукты ПЦР для планирования важных задач, таких как методы расщепления и лигирования, клонирование Гибсона и сборка Golden Gate.

Приложение представляет собой мощный инструмент, который используется не только для разработки букварей. С помощью более 10 инструментов на одной унифицированной платформе вы также можете создавать аннотации последовательностей, выполнять выравнивание и проектировать направляющие РНК CRISPR (гРНК). Вы также можете легко обмениваться проектами и хранить их, поскольку инструмент интегрирован с облачным блокнотом и реестром Benchling.

Дизайн конструкции КРИСПР Клонирование
  • – Клонирование на основе ограничений
  • — Сборка Gibson и Golden Gate
  • – Массовая сборка
  • — Оптимизация и трансляция кодонов
  • – Дизайн направляющей РНК
  • — Подсчет очков в цель / вне цели
  • – Шаблоны кадров
  • — Сборка плазмиды
  • – Поиск ферментов
  • – Виртуальные дайджесты
  • – Сайты ферментативной резки
  • – Библиотека лестниц
  • — Список ферментов
Выравнивание последовательности Анализ аминокислот/белков Визуализация последовательности
  • – Выравнивание по шаблонам
  • – Консенсусное согласование
  • — Массовое автовыравнивание
  • – Выравнивание аминокислот
  • – Автозаполнение переводов
  • – Схемы нумерации антител
  • — идентификация CDR
  • — Идентификация сайта PTM
  • – Карта плазмидов
  • — Настройка ORF
  • – Аннотации
  • — Массовые автоматические аннотации
  • — Поиск последовательности

Дизайнерские грунтовки с Benchling

С помощью Benchling вы можете легко разрабатывать и анализировать праймеры в режиме онлайн.Разработайте праймеры для количественной ПЦР, ПЦР, клонирования и секвенирования. Некоторые основные моменты включают:

  • Быстро визуализируйте сайты связывания праймеров в интересующей последовательности и отслеживайте последовательности, для которых используются праймеры.
  • Легко присоединяйте один праймер к последовательности или связывайте их попарно. Файлы последовательности праймеров, называемые в Benchling «олиго», содержат список всех последовательностей, к которым они когда-либо были присоединены, что обеспечивает полную отслеживаемость вашей библиотеки праймеров.

Вы можете создавать праймеры в Benchling вручную или с помощью мастера праймеров.Если ваш праймер уже разработан, вы также можете легко найти любые существующие праймеры для присоединения к своей последовательности или импортировать олигонуклеотиды в Benchling. Давайте посмотрим, на что способен инструмент проектирования праймеров Benchling.

Рисунок 6. Дизайн праймера в Benchling

 

Дизайн ручной грунтовки

Вы можете создать праймеры вручную на платформе Benchling из последовательностей, которые уже используются в вашей организации. Чтобы разработать праймеры вручную, выделите область шаблонной ДНК на карте последовательности, выбрав нужный диапазон, щелкнув правой кнопкой мыши и выбрав создание прямого или обратного праймера.

Рисунок 7а. Ручной дизайн грунтовки в Benchling

 

Далее, на вкладке «Дизайн», вы можете сфокусироваться на основаниях выбранной последовательности, обозначить «выступ» и включить сайты рестрикционных ферментов.

Рисунок 7б. Ручной дизайн грунтовки в Benchling

 

После проектирования быстро проверьте свои праймеры автоматически на вкладке «Проверка». В интерфейсе доступно следующее:

  • Значения свободной энергии Гиббса для гомодимера и мономеров
  • Температуры плавления и содержание ГХ
  • Схемы вторичной структуры для димеров

Вы даже можете настроить термодинамические параметры, чтобы изменить способ расчета температуры плавления, щелкнув значок гаечного ключа.После завершения проектирования присвойте имя праймеру и сохраните его в библиотеке праймеров.

Рисунок 7с. Ручной дизайн грунтовки в Benchling

 

Wizard Primer Design

Вы также можете создавать праймеры с помощью мастера праймеров, который автоматически создает праймеры для вашей целевой последовательности с использованием технологии Primer3. Benchling поддерживает разработку трех основных типов праймеров: PCR, qPCR и праймеров для секвенирования. На каждом шаге мастера задайте нужные параметры. Отрегулируйте содержание GC, температуру плавления, длину, зажим GC, длину ампликона и многое другое.

Удобный поиск, импорт и присоединение существующих праймеров

Если ваш букварь уже разработан, с помощью Benchling вы также можете быстро найти, импортировать и прикрепить любые существующие учебники.

Найдите существующие праймеры, которые связываются с вашей последовательностью, на основе определенных параметров праймеров, таких как длина, температура плавления и количество допустимых несоответствий, и Benchling покажет их сохраненные местоположения. Выберите нужные праймеры и просмотрите их в привязке к карте последовательности.

В качестве альтернативы можно импортировать праймеры с помощью функции Import Oligios в Benchling и быстро добавлять любые из уже существующих праймеров вашей организации.

Рис. 8. Дизайн праймера в Benchling с помощью мастера

 

Это особенно полезно, если вы переносите какие-либо праймеры в Benchling из другого инструмента, такого как Vector NTI, Snapgene или Geneious. Benchling поддерживает различные типы файлов последовательностей и переносит любые аннотации и теги, связанные с последовательностями.

Наконец, после разработки или сохранения вы можете прикрепить праймеры к выбранной последовательности. Все сохраненные праймеры перечислены в меню инструментов праймеров для любого файла последовательности, над которым вы работаете.

Присоединение существующих праймеров в Benchling позволяет автоматически находить существующие праймеры, которые связываются с вашей последовательностью, быстро визуализировать сайты связывания праймеров и просматривать все файлы последовательностей, к которым прикреплен любой олигофайл (праймер).

Отправить праймеры в NCBI Blast

С помощью Benchling пользователь может легко проверить специфичность праймеров, отправив олигонуклеотиды через инструмент праймеров NCBI Blast. Оказавшись внутри Benchling, просто щелкните и перетащите карту последовательности, чтобы выделить праймер (или любую другую интересующую последовательность), щелкните правой кнопкой мыши и отправьте в NCBI Blast.Последовательность отправляется в программу BLASTN, которая ищет нуклеотиды.

Рис. 9. Инструмент для пескоструйной обработки NCBI Primer в модели Benchling

 

NCBI предоставляет инструмент NCBI Primer Blast для создания праймеров, но он требует, чтобы вы каждый раз вводили или копировали/вставляли последовательность олигонуклеотидов для создания праймеров. И после создания вы должны постоянно импортировать разработанный праймер в Benchling или ваш инструмент молекулярной биологии. Простое использование Benchling даст вам одно центральное место для всего рабочего процесса, в то же время позволяя вам легко отправлять свои олигонуклеотиды в инструмент для пескоструйной обработки грунтовки NCBI.

Создание пользовательских библиотек праймеров

Делитесь пользовательскими библиотеками праймеров со своими коллегами, чтобы вам никогда не приходилось задумываться о том, какие праймеры уже были разработаны и использовались в прошлом. Проекты основаны на определенных разрешениях, что позволяет командам настраивать пользовательские библиотеки по мере необходимости. Возможность записывать праймеры и делиться ими — это лишь одна из причин, по которой Eligo Bioscience любит Benchling.

ПЦР in silico в Benchling

С помощью Benchling пользователь может легко проверить специфичность праймеров, отправив олигонуклеотиды через систему. После создания праймеров вы можете провести ПЦР in silico с помощью Benchling.Просто выберите прямой и обратный праймеры, соедините их как пару и создавайте продукты ПЦР двумя щелчками мыши.

Рис. 10. Запуск ПЦР in silico в Benchling

 

После разработки функциональных праймеров и амплификации продуктов ПЦР (ампликонов) платформа Benchling может продолжать моделировать последующие процедуры, такие как расщепление и лигирование, дизайн плазмид, трансфекция и методы клонирования, такие как Gibson и Golden Gate Assembly.

Пользователь может «@» упомянуть любые продукты ПЦР, дайджесты, плазмиды или файлы праймеров непосредственно в записи Notebook и автоматически зарегистрировать их в реестре Benchling.Свяжите любую из этих процедур in silico с фактическим образцом, используемым в лаборатории, с помощью Benchling Inventory. Связывая эти проекты с физическими продуктами в лаборатории, Benchling предоставляет вам централизованный доступ ко всем экспериментальным данным и обмен ими с различными учеными и командами.

Бесплатные инструменты для разработки учебных пособий

Benchling for Academics предлагает Benchling Molecular Biology, включая инструменты для разработки праймеров, дизайна гРНК CRISPR, выравнивания и т. д., а также Benchling Notebook бесплатно для студентов, аспирантов, докторантов и любых других ученых.

Благодаря тому, что более 180 000 ученых по всему миру используют Benchling, мы инвестируем в воспитание следующего поколения биологов. Наличие доступа к бесплатным, современным и удобным для пользователя инструментам позволяет академическому сообществу быстрее делать новаторские открытия и тратить меньше времени на заметки в бумажных блокнотах, поиск данных в автономных инструментах и ​​выполнение подверженного ошибкам ручного ввода данных. Вот несколько полезных советов для ученых от пользователей Benchling for Academics о том, как они используют этот инструмент для повышения уровня своих исследований.

Benchling for Academics также полезен профессорам и учителям естественных наук. Преподаватели теперь могут столкнуться с дополнительной проблемой удаленного преподавания курсов из-за пандемии коронавируса. Без доступа к мокрым лабораторным курсам студентам может быть сложно понять концепции, лежащие в основе методов молекулярной биологии. Но при правильном подходе профессора и преподаватели могут использовать Benchling для адаптации лабораторных курсов к виртуальному обучению.

Запросить демо для Benchling

Если вы хотите узнать больше о том, что Benchling может предложить вашим научным группам, запросите демонстрацию на сайте Benchling.com/request-demo.

Дизайн

Primer — это только начало того, что Benchling предлагает нашим клиентам. Benchling — это полностью интегрированная платформа исследований и разработок в области наук о жизни, которая поддерживает продуктивность ученых, отслеживание образцов, управление процессами и аналитику.

Leave a Reply

Добавить комментарий

Ваш адрес email не будет опубликован.